Incidental Mutation 'R4698:Aadacl2'
ID355817
Institutional Source Beutler Lab
Gene Symbol Aadacl2
Ensembl Gene ENSMUSG00000091376
Gene Namearylacetamide deacetylase like 2
SynonymsEG639634
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location60006743-60025420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60025039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 325 (D325G)
Ref Sequence ENSEMBL: ENSMUSP00000129444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169794]
Predicted Effect probably benign
Transcript: ENSMUST00000169794
AA Change: D325G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129444
Gene: ENSMUSG00000091376
AA Change: D325G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 219 2.7e-7 PFAM
Pfam:Abhydrolase_3 107 272 8.2e-38 PFAM
Pfam:Abhydrolase_3 270 375 3.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195422
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Aadacl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Aadacl2 APN 3 60024676 missense probably benign
IGL01626:Aadacl2 APN 3 60019174 missense probably damaging 1.00
IGL01777:Aadacl2 APN 3 60024784 missense possibly damaging 0.61
IGL02189:Aadacl2 APN 3 60025188 missense probably damaging 0.99
IGL03238:Aadacl2 APN 3 60024918 missense probably benign 0.31
R0369:Aadacl2 UTSW 3 60024722 nonsense probably null
R0540:Aadacl2 UTSW 3 60019206 missense possibly damaging 0.50
R1440:Aadacl2 UTSW 3 60024892 missense probably damaging 0.99
R1589:Aadacl2 UTSW 3 60010576 missense probably benign 0.00
R1778:Aadacl2 UTSW 3 60017450 splice site probably null
R1781:Aadacl2 UTSW 3 60024696 missense probably damaging 1.00
R1812:Aadacl2 UTSW 3 60025077 missense probably damaging 1.00
R2411:Aadacl2 UTSW 3 60017423 missense possibly damaging 0.94
R4622:Aadacl2 UTSW 3 60007053 missense probably damaging 1.00
R5326:Aadacl2 UTSW 3 60025063 missense probably damaging 1.00
R5542:Aadacl2 UTSW 3 60025063 missense probably damaging 1.00
R6314:Aadacl2 UTSW 3 60017403 missense probably damaging 1.00
R6469:Aadacl2 UTSW 3 60024789 missense probably benign 0.24
R6953:Aadacl2 UTSW 3 60024760 missense possibly damaging 0.78
R7082:Aadacl2 UTSW 3 60024885 missense probably damaging 1.00
R7206:Aadacl2 UTSW 3 60025241 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCACCAAGGATGAGGCACTTC -3'
(R):5'- AGCCCTAGATCTAAGTGAAGTGG -3'

Sequencing Primer
(F):5'- GGCACTTCCACAGGCAATGAG -3'
(R):5'- GGCGATGTCATATATGATAAGGCTCC -3'
Posted On2015-10-21