Incidental Mutation 'R4698:Celf3'
ID 355819
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene Name CUGBP, Elav-like family member 3
Synonyms BRUNOL1, Tnrc4, CAGH4, ERDA4, 4930415M08Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.245) question?
Stock # R4698 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 94385602-94399505 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 94392174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000197677] [ENSMUST00000198384] [ENSMUST00000198384] [ENSMUST00000198316] [ENSMUST00000199775] [ENSMUST00000199775] [ENSMUST00000199884] [ENSMUST00000199884] [ENSMUST00000200342]
AlphaFold Q8CIN6
Predicted Effect probably null
Transcript: ENSMUST00000029784
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably null
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199775
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199775
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199884
Predicted Effect probably null
Transcript: ENSMUST00000199884
Predicted Effect probably null
Transcript: ENSMUST00000200342
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,349,049 (GRCm39) V11A possibly damaging Het
6030452D12Rik T C 8: 107,230,979 (GRCm39) I55T unknown Het
Aadacl2 A G 3: 59,932,460 (GRCm39) D325G probably benign Het
Adh1 A G 3: 137,988,274 (GRCm39) S113G probably benign Het
Agxt2 T C 15: 10,392,130 (GRCm39) probably null Het
Aicda C T 6: 122,530,847 (GRCm39) probably benign Het
Aifm2 T C 10: 61,563,535 (GRCm39) M135T probably benign Het
Asah2 T C 19: 32,031,871 (GRCm39) probably null Het
Btbd17 T C 11: 114,682,543 (GRCm39) R390G probably damaging Het
Cadps T C 14: 12,705,654 (GRCm38) E247G possibly damaging Het
Cds2 T C 2: 132,146,873 (GRCm39) I383T probably damaging Het
Crhr2 T C 6: 55,079,852 (GRCm39) S162G possibly damaging Het
Dapl1 A T 2: 59,335,118 (GRCm39) K91* probably null Het
Ddx60 A C 8: 62,465,458 (GRCm39) M1372L probably benign Het
Dnah2 A T 11: 69,389,358 (GRCm39) F845I probably damaging Het
Dscam T C 16: 96,411,524 (GRCm39) D1784G probably damaging Het
Ech1 T C 7: 28,531,478 (GRCm39) V310A probably benign Het
Eef1g A G 19: 8,955,330 (GRCm39) D393G possibly damaging Het
Eif3k T C 7: 28,671,969 (GRCm39) I172V possibly damaging Het
Foxd4 A G 19: 24,877,625 (GRCm39) F192L probably damaging Het
Gpr153 T A 4: 152,366,240 (GRCm39) S268R probably damaging Het
H3c13 C A 3: 96,176,394 (GRCm39) R129S probably damaging Het
Ivl T C 3: 92,478,698 (GRCm39) K456E unknown Het
Kif20b A T 19: 34,928,944 (GRCm39) D1190V probably damaging Het
Kif21a T A 15: 90,840,508 (GRCm39) I1223L possibly damaging Het
Lmf1 T C 17: 25,798,324 (GRCm39) V55A probably damaging Het
Loxhd1 A G 18: 77,459,987 (GRCm39) E659G possibly damaging Het
Lrrc37a T C 11: 103,394,930 (GRCm39) E165G possibly damaging Het
Mios T C 6: 8,228,113 (GRCm39) Y677H possibly damaging Het
Mnx1 T A 5: 29,679,057 (GRCm39) K342M unknown Het
Mtpap A T 18: 4,375,724 (GRCm39) T35S possibly damaging Het
Ndc1 C G 4: 107,268,334 (GRCm39) D623E probably benign Het
Nedd4l A G 18: 65,336,951 (GRCm39) Y666C probably damaging Het
Or52s6 T A 7: 103,091,842 (GRCm39) I163F possibly damaging Het
Or5ac22 T C 16: 59,135,720 (GRCm39) T17A probably damaging Het
Or5b12b T G 19: 12,861,985 (GRCm39) F247V probably benign Het
Or5m10b A G 2: 85,699,596 (GRCm39) Y220C possibly damaging Het
Papss1 G T 3: 131,313,092 (GRCm39) V369F probably damaging Het
Pcdhac2 T A 18: 37,278,822 (GRCm39) Y601N probably damaging Het
Pde7a C T 3: 19,365,095 (GRCm39) R24Q probably damaging Het
Phf21a A G 2: 92,187,297 (GRCm39) D445G probably damaging Het
Plekho1 T A 3: 95,902,964 (GRCm39) N15I possibly damaging Het
Pprc1 T C 19: 46,057,634 (GRCm39) probably benign Het
Ralgapa1 A T 12: 55,724,061 (GRCm39) probably null Het
Rrp12 T C 19: 41,861,481 (GRCm39) E942G probably benign Het
Skor1 T C 9: 63,051,830 (GRCm39) D685G probably benign Het
Smim23 A T 11: 32,774,510 (GRCm39) I3N possibly damaging Het
Spata7 A T 12: 98,630,536 (GRCm39) I333F probably damaging Het
Sppl2c T C 11: 104,079,141 (GRCm39) I647T probably benign Het
Srgap1 C A 10: 121,628,392 (GRCm39) R837L probably benign Het
Stpg2 C A 3: 139,014,990 (GRCm39) P385H probably damaging Het
Tmem238 C A 7: 4,792,016 (GRCm39) E19* probably null Het
Top2b A T 14: 16,387,331 (GRCm38) K140* probably null Het
Trp53 T A 11: 69,479,248 (GRCm39) L142* probably null Het
Tyro3 A T 2: 119,633,751 (GRCm39) D133V probably damaging Het
Virma T A 4: 11,528,636 (GRCm39) I1291N probably damaging Het
Vmn1r213 A G 13: 23,195,507 (GRCm39) probably benign Het
Zbtb10 T C 3: 9,329,610 (GRCm39) S323P possibly damaging Het
Zfp521 A T 18: 13,978,660 (GRCm39) N584K probably damaging Het
Zfp944 A G 17: 22,558,180 (GRCm39) C356R probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94,395,535 (GRCm39) missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94,394,108 (GRCm39) missense probably damaging 1.00
IGL03007:Celf3 APN 3 94,394,444 (GRCm39) missense probably benign 0.00
R0180:Celf3 UTSW 3 94,392,647 (GRCm39) missense probably damaging 1.00
R0670:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R1965:Celf3 UTSW 3 94,392,634 (GRCm39) missense probably damaging 1.00
R2232:Celf3 UTSW 3 94,387,566 (GRCm39) splice site probably null
R2566:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R3546:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3547:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3548:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R4015:Celf3 UTSW 3 94,394,505 (GRCm39) missense probably benign 0.02
R4471:Celf3 UTSW 3 94,395,585 (GRCm39) splice site probably null
R4816:Celf3 UTSW 3 94,386,529 (GRCm39) missense probably damaging 1.00
R4939:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R5851:Celf3 UTSW 3 94,386,433 (GRCm39) missense probably damaging 1.00
R6277:Celf3 UTSW 3 94,392,672 (GRCm39) missense probably damaging 1.00
R6400:Celf3 UTSW 3 94,387,593 (GRCm39) missense probably damaging 1.00
R6986:Celf3 UTSW 3 94,395,024 (GRCm39) missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94,387,637 (GRCm39) missense probably damaging 0.99
R7556:Celf3 UTSW 3 94,387,590 (GRCm39) missense probably damaging 1.00
R8141:Celf3 UTSW 3 94,395,850 (GRCm39) missense probably damaging 1.00
R8290:Celf3 UTSW 3 94,386,489 (GRCm39) missense probably benign 0.44
R8978:Celf3 UTSW 3 94,392,667 (GRCm39) missense probably benign 0.22
R9255:Celf3 UTSW 3 94,392,594 (GRCm39) missense probably benign 0.25
R9636:Celf3 UTSW 3 94,394,580 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATTCTAGACAAGGTTGGGCC -3'
(R):5'- GCTCTGAAGGACGTGAACTC -3'

Sequencing Primer
(F):5'- CTACCCTTTCCTTTCCATCAACTGAG -3'
(R):5'- CTCTGAAGGACGTGAACTCTACTTG -3'
Posted On 2015-10-21