Incidental Mutation 'R4698:Olfr605'
ID355838
Institutional Source Beutler Lab
Gene Symbol Olfr605
Ensembl Gene ENSMUSG00000109659
Gene Nameolfactory receptor 605
SynonymsGA_x6K02T2PBJ9-6164792-6163848, MOR24-5, MOR202-22P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103440407-103445439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103442635 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 163 (I163F)
Ref Sequence ENSEMBL: ENSMUSP00000151125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080660] [ENSMUST00000215417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080660
AA Change: I163F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079489
Gene: ENSMUSG00000109659
AA Change: I163F

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 305 1.9e-9 PFAM
Pfam:7tm_1 43 294 6.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215417
AA Change: I163F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Olfr605
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Olfr605 APN 7 103442952 missense probably damaging 1.00
IGL03219:Olfr605 APN 7 103442538 missense possibly damaging 0.51
IGL03265:Olfr605 APN 7 103442448 missense probably benign 0.18
IGL03404:Olfr605 APN 7 103442988 missense possibly damaging 0.78
R0294:Olfr605 UTSW 7 103443084 missense possibly damaging 0.77
R0465:Olfr605 UTSW 7 103442835 missense possibly damaging 0.67
R4758:Olfr605 UTSW 7 103442869 missense probably damaging 1.00
R5447:Olfr605 UTSW 7 103442940 missense probably damaging 0.99
R5595:Olfr605 UTSW 7 103442428 missense probably damaging 1.00
R7196:Olfr605 UTSW 7 103442997 missense probably benign 0.15
R7202:Olfr605 UTSW 7 103443085 missense probably benign 0.00
R7291:Olfr605 UTSW 7 103442788 missense probably benign 0.00
R7636:Olfr605 UTSW 7 103442833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTCGAGATGGAAGACG -3'
(R):5'- CACCTTCGATGCATGCCTTG -3'

Sequencing Primer
(F):5'- CTTCTCGAGATGGAAGACGAAAAAC -3'
(R):5'- TGCTCAAATGTTCTTCATCCATAG -3'
Posted On2015-10-21