Incidental Mutation 'R4698:Spata7'
ID355852
Institutional Source Beutler Lab
Gene Symbol Spata7
Ensembl Gene ENSMUSG00000021007
Gene Namespermatogenesis associated 7
SynonymsB230306G18Rik, HSD3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98628157-98669815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98664277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 333 (I333F)
Ref Sequence ENSEMBL: ENSMUSP00000098705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048402] [ENSMUST00000101144] [ENSMUST00000101146]
Predicted Effect probably damaging
Transcript: ENSMUST00000048402
AA Change: I365F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045827
Gene: ENSMUSG00000021007
AA Change: I365F

DomainStartEndE-ValueType
Pfam:HSD3 9 410 1e-190 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000101144
AA Change: I198F
SMART Domains Protein: ENSMUSP00000098704
Gene: ENSMUSG00000021007
AA Change: I198F

DomainStartEndE-ValueType
Pfam:HSD3 6 131 7.5e-73 PFAM
Pfam:HSD3 122 244 6e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101146
AA Change: I333F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098705
Gene: ENSMUSG00000021007
AA Change: I333F

DomainStartEndE-ValueType
Pfam:HSD3 6 33 1e-11 PFAM
Pfam:HSD3 31 379 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152482
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele display progressive retinal rod cell degeneration, a thin retinal outer nuclear layer and impaired scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Spata7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spata7 APN 12 98668840 missense probably damaging 1.00
IGL02283:Spata7 APN 12 98658258 missense probably damaging 0.96
IGL02379:Spata7 APN 12 98634260 missense probably damaging 1.00
R0200:Spata7 UTSW 12 98663169 missense probably benign 0.32
R0422:Spata7 UTSW 12 98658265 missense probably damaging 0.99
R0847:Spata7 UTSW 12 98648430 missense possibly damaging 0.82
R1228:Spata7 UTSW 12 98634269 missense probably damaging 1.00
R1497:Spata7 UTSW 12 98668861 missense probably damaging 1.00
R1693:Spata7 UTSW 12 98664257 missense possibly damaging 0.85
R2183:Spata7 UTSW 12 98637612 missense probably damaging 1.00
R2507:Spata7 UTSW 12 98658450 missense probably benign
R3176:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3177:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3276:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3277:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3951:Spata7 UTSW 12 98669473 missense probably damaging 0.98
R4919:Spata7 UTSW 12 98648453 missense possibly damaging 0.65
R5088:Spata7 UTSW 12 98669502 missense probably benign 0.43
R5583:Spata7 UTSW 12 98669331 missense probably damaging 0.98
R6414:Spata7 UTSW 12 98663220 critical splice donor site probably null
R6451:Spata7 UTSW 12 98658337 missense probably benign 0.02
R7167:Spata7 UTSW 12 98664296 missense probably damaging 1.00
R7316:Spata7 UTSW 12 98658612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTGGGTGCTAATTTCTCAC -3'
(R):5'- GTTTTCTATGGAGTGTGAAACAGCC -3'

Sequencing Primer
(F):5'- GTTGGGTGCTAATTTCTCACTTTTAC -3'
(R):5'- AAAGTCACATAGTGTGA -3'
Posted On2015-10-21