Incidental Mutation 'R4698:Cadps'
ID355854
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4698 (G1)
Quality Score192
Status Not validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12705654 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 247 (E247G)
Ref Sequence ENSEMBL: ENSMUSP00000136076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067491
AA Change: E247G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112657
AA Change: E247G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112658
AA Change: E247G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177814
AA Change: E247G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224882
AA Change: E247G

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
R7674:Cadps UTSW 14 12411581 missense probably damaging 0.99
R7715:Cadps UTSW 14 12457762 missense probably benign 0.01
R7801:Cadps UTSW 14 12489476 critical splice donor site probably null
R7814:Cadps UTSW 14 12376706 missense probably damaging 0.99
R7915:Cadps UTSW 14 12705544 missense possibly damaging 0.84
R8087:Cadps UTSW 14 12536380 missense probably damaging 1.00
R8109:Cadps UTSW 14 12488975 missense probably benign 0.00
R8485:Cadps UTSW 14 12439872 missense probably damaging 1.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Z1177:Cadps UTSW 14 12465880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGAAGTGACTCTTGAAAGTGGTTC -3'
(R):5'- TCTCAAGAGTGACCGTGTGG -3'

Sequencing Primer
(F):5'- TGAAAGTGGTTCCACTGACC -3'
(R):5'- GCCCGCATGGTGCAGAG -3'
Posted On2015-10-21