Incidental Mutation 'R4698:Top2b'
ID 355855
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R4698 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 16387331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 140 (K140*)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably null
Transcript: ENSMUST00000017629
AA Change: K140*
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: K140*

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159987
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,349,049 (GRCm39) V11A possibly damaging Het
6030452D12Rik T C 8: 107,230,979 (GRCm39) I55T unknown Het
Aadacl2 A G 3: 59,932,460 (GRCm39) D325G probably benign Het
Adh1 A G 3: 137,988,274 (GRCm39) S113G probably benign Het
Agxt2 T C 15: 10,392,130 (GRCm39) probably null Het
Aicda C T 6: 122,530,847 (GRCm39) probably benign Het
Aifm2 T C 10: 61,563,535 (GRCm39) M135T probably benign Het
Asah2 T C 19: 32,031,871 (GRCm39) probably null Het
Btbd17 T C 11: 114,682,543 (GRCm39) R390G probably damaging Het
Cadps T C 14: 12,705,654 (GRCm38) E247G possibly damaging Het
Cds2 T C 2: 132,146,873 (GRCm39) I383T probably damaging Het
Celf3 T A 3: 94,392,174 (GRCm39) probably null Het
Crhr2 T C 6: 55,079,852 (GRCm39) S162G possibly damaging Het
Dapl1 A T 2: 59,335,118 (GRCm39) K91* probably null Het
Ddx60 A C 8: 62,465,458 (GRCm39) M1372L probably benign Het
Dnah2 A T 11: 69,389,358 (GRCm39) F845I probably damaging Het
Dscam T C 16: 96,411,524 (GRCm39) D1784G probably damaging Het
Ech1 T C 7: 28,531,478 (GRCm39) V310A probably benign Het
Eef1g A G 19: 8,955,330 (GRCm39) D393G possibly damaging Het
Eif3k T C 7: 28,671,969 (GRCm39) I172V possibly damaging Het
Foxd4 A G 19: 24,877,625 (GRCm39) F192L probably damaging Het
Gpr153 T A 4: 152,366,240 (GRCm39) S268R probably damaging Het
H3c13 C A 3: 96,176,394 (GRCm39) R129S probably damaging Het
Ivl T C 3: 92,478,698 (GRCm39) K456E unknown Het
Kif20b A T 19: 34,928,944 (GRCm39) D1190V probably damaging Het
Kif21a T A 15: 90,840,508 (GRCm39) I1223L possibly damaging Het
Lmf1 T C 17: 25,798,324 (GRCm39) V55A probably damaging Het
Loxhd1 A G 18: 77,459,987 (GRCm39) E659G possibly damaging Het
Lrrc37a T C 11: 103,394,930 (GRCm39) E165G possibly damaging Het
Mios T C 6: 8,228,113 (GRCm39) Y677H possibly damaging Het
Mnx1 T A 5: 29,679,057 (GRCm39) K342M unknown Het
Mtpap A T 18: 4,375,724 (GRCm39) T35S possibly damaging Het
Ndc1 C G 4: 107,268,334 (GRCm39) D623E probably benign Het
Nedd4l A G 18: 65,336,951 (GRCm39) Y666C probably damaging Het
Or52s6 T A 7: 103,091,842 (GRCm39) I163F possibly damaging Het
Or5ac22 T C 16: 59,135,720 (GRCm39) T17A probably damaging Het
Or5b12b T G 19: 12,861,985 (GRCm39) F247V probably benign Het
Or5m10b A G 2: 85,699,596 (GRCm39) Y220C possibly damaging Het
Papss1 G T 3: 131,313,092 (GRCm39) V369F probably damaging Het
Pcdhac2 T A 18: 37,278,822 (GRCm39) Y601N probably damaging Het
Pde7a C T 3: 19,365,095 (GRCm39) R24Q probably damaging Het
Phf21a A G 2: 92,187,297 (GRCm39) D445G probably damaging Het
Plekho1 T A 3: 95,902,964 (GRCm39) N15I possibly damaging Het
Pprc1 T C 19: 46,057,634 (GRCm39) probably benign Het
Ralgapa1 A T 12: 55,724,061 (GRCm39) probably null Het
Rrp12 T C 19: 41,861,481 (GRCm39) E942G probably benign Het
Skor1 T C 9: 63,051,830 (GRCm39) D685G probably benign Het
Smim23 A T 11: 32,774,510 (GRCm39) I3N possibly damaging Het
Spata7 A T 12: 98,630,536 (GRCm39) I333F probably damaging Het
Sppl2c T C 11: 104,079,141 (GRCm39) I647T probably benign Het
Srgap1 C A 10: 121,628,392 (GRCm39) R837L probably benign Het
Stpg2 C A 3: 139,014,990 (GRCm39) P385H probably damaging Het
Tmem238 C A 7: 4,792,016 (GRCm39) E19* probably null Het
Trp53 T A 11: 69,479,248 (GRCm39) L142* probably null Het
Tyro3 A T 2: 119,633,751 (GRCm39) D133V probably damaging Het
Virma T A 4: 11,528,636 (GRCm39) I1291N probably damaging Het
Vmn1r213 A G 13: 23,195,507 (GRCm39) probably benign Het
Zbtb10 T C 3: 9,329,610 (GRCm39) S323P possibly damaging Het
Zfp521 A T 18: 13,978,660 (GRCm39) N584K probably damaging Het
Zfp944 A G 17: 22,558,180 (GRCm39) C356R probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACACTGACTTACATCTTGCTGTAAC -3'
(R):5'- CTGTCAGTTAGATTAGAATTCCAGC -3'

Sequencing Primer
(F):5'- ACATCTTGCTGTAACCATTCAAG -3'
(R):5'- CTTTAGAGGATTTTCTCACAATA -3'
Posted On 2015-10-21