Mutagenetix > Incidental Mutation

Incidental Mutation 'R4698:Top2b'

355855

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R4698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 16387331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 140 (K140*)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably null
Transcript: ENSMUST00000017629
AA Change: K140*

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: K140*

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159987

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	G	17: 48,038,240	V11A	possibly damaging	Het
6030452D12Rik	T	C	8: 106,504,347	I55T	unknown	Het
Aadacl2	A	G	3: 60,025,039	D325G	probably benign	Het
Adh1	A	G	3: 138,282,513	S113G	probably benign	Het
Agxt2	T	C	15: 10,392,044		probably null	Het
Aicda	C	T	6: 122,553,888		probably benign	Het
Aifm2	T	C	10: 61,727,756	M135T	probably benign	Het
Asah2	T	C	19: 32,054,471		probably null	Het
Btbd17	T	C	11: 114,791,717	R390G	probably damaging	Het
Cadps	T	C	14: 12,705,654	E247G	possibly damaging	Het
Cds2	T	C	2: 132,304,953	I383T	probably damaging	Het
Celf3	T	A	3: 94,484,867		probably null	Het
Crhr2	T	C	6: 55,102,867	S162G	possibly damaging	Het
Dapl1	A	T	2: 59,504,774	K91*	probably null	Het
Ddx60	A	C	8: 62,012,424	M1372L	probably benign	Het
Dnah2	A	T	11: 69,498,532	F845I	probably damaging	Het
Dscam	T	C	16: 96,610,324	D1784G	probably damaging	Het
Ech1	T	C	7: 28,832,053	V310A	probably benign	Het
Eef1g	A	G	19: 8,977,966	D393G	possibly damaging	Het
Eif3k	T	C	7: 28,972,544	I172V	possibly damaging	Het
Foxd4	A	G	19: 24,900,261	F192L	probably damaging	Het
Gpr153	T	A	4: 152,281,783	S268R	probably damaging	Het
Hist2h3b	C	A	3: 96,269,078	R129S	probably damaging	Het
Ivl	T	C	3: 92,571,391	K456E	unknown	Het
Kif20b	A	T	19: 34,951,544	D1190V	probably damaging	Het
Kif21a	T	A	15: 90,956,305	I1223L	possibly damaging	Het
Lmf1	T	C	17: 25,579,350	V55A	probably damaging	Het
Loxhd1	A	G	18: 77,372,291	E659G	possibly damaging	Het
Lrrc37a	T	C	11: 103,504,104	E165G	possibly damaging	Het
Mios	T	C	6: 8,228,113	Y677H	possibly damaging	Het
Mnx1	T	A	5: 29,474,059	K342M	unknown	Het
Mtpap	A	T	18: 4,375,724	T35S	possibly damaging	Het
Ndc1	C	G	4: 107,411,137	D623E	probably benign	Het
Nedd4l	A	G	18: 65,203,880	Y666C	probably damaging	Het
Olfr1022	A	G	2: 85,869,252	Y220C	possibly damaging	Het
Olfr1445	T	G	19: 12,884,621	F247V	probably benign	Het
Olfr204	T	C	16: 59,315,357	T17A	probably damaging	Het
Olfr605	T	A	7: 103,442,635	I163F	possibly damaging	Het
Papss1	G	T	3: 131,607,331	V369F	probably damaging	Het
Pcdhac2	T	A	18: 37,145,769	Y601N	probably damaging	Het
Pde7a	C	T	3: 19,310,931	R24Q	probably damaging	Het
Phf21a	A	G	2: 92,356,952	D445G	probably damaging	Het
Plekho1	T	A	3: 95,995,652	N15I	possibly damaging	Het
Pprc1	T	C	19: 46,069,195		probably benign	Het
Ralgapa1	A	T	12: 55,677,276		probably null	Het
Rrp12	T	C	19: 41,873,042	E942G	probably benign	Het
Skor1	T	C	9: 63,144,548	D685G	probably benign	Het
Smim23	A	T	11: 32,824,510	I3N	possibly damaging	Het
Spata7	A	T	12: 98,664,277	I333F	probably damaging	Het
Sppl2c	T	C	11: 104,188,315	I647T	probably benign	Het
Srgap1	C	A	10: 121,792,487	R837L	probably benign	Het
Stpg2	C	A	3: 139,309,229	P385H	probably damaging	Het
Tmem238	C	A	7: 4,789,017	E19*	probably null	Het
Trp53	T	A	11: 69,588,422	L142*	probably null	Het
Tyro3	A	T	2: 119,803,270	D133V	probably damaging	Het
Virma	T	A	4: 11,528,636	I1291N	probably damaging	Het
Vmn1r213	A	G	13: 23,011,337		probably benign	Het
Zbtb10	T	C	3: 9,264,550	S323P	possibly damaging	Het
Zfp521	A	T	18: 13,845,603	N584K	probably damaging	Het
Zfp944	A	G	17: 22,339,199	C356R	probably damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACACTGACTTACATCTTGCTGTAAC -3'
(R):5'- CTGTCAGTTAGATTAGAATTCCAGC -3'

Sequencing Primer
(F):5'- ACATCTTGCTGTAACCATTCAAG -3'
(R):5'- CTTTAGAGGATTTTCTCACAATA -3'

Posted On

2015-10-21