Incidental Mutation 'R4698:Dscam'
ID 355860
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4698 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96411524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1784 (D1784G)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably damaging
Transcript: ENSMUST00000056102
AA Change: D1784G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: D1784G

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,349,049 (GRCm39) V11A possibly damaging Het
6030452D12Rik T C 8: 107,230,979 (GRCm39) I55T unknown Het
Aadacl2 A G 3: 59,932,460 (GRCm39) D325G probably benign Het
Adh1 A G 3: 137,988,274 (GRCm39) S113G probably benign Het
Agxt2 T C 15: 10,392,130 (GRCm39) probably null Het
Aicda C T 6: 122,530,847 (GRCm39) probably benign Het
Aifm2 T C 10: 61,563,535 (GRCm39) M135T probably benign Het
Asah2 T C 19: 32,031,871 (GRCm39) probably null Het
Btbd17 T C 11: 114,682,543 (GRCm39) R390G probably damaging Het
Cadps T C 14: 12,705,654 (GRCm38) E247G possibly damaging Het
Cds2 T C 2: 132,146,873 (GRCm39) I383T probably damaging Het
Celf3 T A 3: 94,392,174 (GRCm39) probably null Het
Crhr2 T C 6: 55,079,852 (GRCm39) S162G possibly damaging Het
Dapl1 A T 2: 59,335,118 (GRCm39) K91* probably null Het
Ddx60 A C 8: 62,465,458 (GRCm39) M1372L probably benign Het
Dnah2 A T 11: 69,389,358 (GRCm39) F845I probably damaging Het
Ech1 T C 7: 28,531,478 (GRCm39) V310A probably benign Het
Eef1g A G 19: 8,955,330 (GRCm39) D393G possibly damaging Het
Eif3k T C 7: 28,671,969 (GRCm39) I172V possibly damaging Het
Foxd4 A G 19: 24,877,625 (GRCm39) F192L probably damaging Het
Gpr153 T A 4: 152,366,240 (GRCm39) S268R probably damaging Het
H3c13 C A 3: 96,176,394 (GRCm39) R129S probably damaging Het
Ivl T C 3: 92,478,698 (GRCm39) K456E unknown Het
Kif20b A T 19: 34,928,944 (GRCm39) D1190V probably damaging Het
Kif21a T A 15: 90,840,508 (GRCm39) I1223L possibly damaging Het
Lmf1 T C 17: 25,798,324 (GRCm39) V55A probably damaging Het
Loxhd1 A G 18: 77,459,987 (GRCm39) E659G possibly damaging Het
Lrrc37a T C 11: 103,394,930 (GRCm39) E165G possibly damaging Het
Mios T C 6: 8,228,113 (GRCm39) Y677H possibly damaging Het
Mnx1 T A 5: 29,679,057 (GRCm39) K342M unknown Het
Mtpap A T 18: 4,375,724 (GRCm39) T35S possibly damaging Het
Ndc1 C G 4: 107,268,334 (GRCm39) D623E probably benign Het
Nedd4l A G 18: 65,336,951 (GRCm39) Y666C probably damaging Het
Or52s6 T A 7: 103,091,842 (GRCm39) I163F possibly damaging Het
Or5ac22 T C 16: 59,135,720 (GRCm39) T17A probably damaging Het
Or5b12b T G 19: 12,861,985 (GRCm39) F247V probably benign Het
Or5m10b A G 2: 85,699,596 (GRCm39) Y220C possibly damaging Het
Papss1 G T 3: 131,313,092 (GRCm39) V369F probably damaging Het
Pcdhac2 T A 18: 37,278,822 (GRCm39) Y601N probably damaging Het
Pde7a C T 3: 19,365,095 (GRCm39) R24Q probably damaging Het
Phf21a A G 2: 92,187,297 (GRCm39) D445G probably damaging Het
Plekho1 T A 3: 95,902,964 (GRCm39) N15I possibly damaging Het
Pprc1 T C 19: 46,057,634 (GRCm39) probably benign Het
Ralgapa1 A T 12: 55,724,061 (GRCm39) probably null Het
Rrp12 T C 19: 41,861,481 (GRCm39) E942G probably benign Het
Skor1 T C 9: 63,051,830 (GRCm39) D685G probably benign Het
Smim23 A T 11: 32,774,510 (GRCm39) I3N possibly damaging Het
Spata7 A T 12: 98,630,536 (GRCm39) I333F probably damaging Het
Sppl2c T C 11: 104,079,141 (GRCm39) I647T probably benign Het
Srgap1 C A 10: 121,628,392 (GRCm39) R837L probably benign Het
Stpg2 C A 3: 139,014,990 (GRCm39) P385H probably damaging Het
Tmem238 C A 7: 4,792,016 (GRCm39) E19* probably null Het
Top2b A T 14: 16,387,331 (GRCm38) K140* probably null Het
Trp53 T A 11: 69,479,248 (GRCm39) L142* probably null Het
Tyro3 A T 2: 119,633,751 (GRCm39) D133V probably damaging Het
Virma T A 4: 11,528,636 (GRCm39) I1291N probably damaging Het
Vmn1r213 A G 13: 23,195,507 (GRCm39) probably benign Het
Zbtb10 T C 3: 9,329,610 (GRCm39) S323P possibly damaging Het
Zfp521 A T 18: 13,978,660 (GRCm39) N584K probably damaging Het
Zfp944 A G 17: 22,558,180 (GRCm39) C356R probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTAAGGCCTTGCACACAG -3'
(R):5'- ACACAATACCCCTTATTTGTTGCAG -3'

Sequencing Primer
(F):5'- GAACACTTGGCCTGGGAACTC -3'
(R):5'- TGTTGCAGATCCCACCAC -3'
Posted On 2015-10-21