Incidental Mutation 'R4698:Lmf1'
ID355862
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25579350 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000114651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063344
AA Change: V55A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: V55A

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116641
AA Change: V55A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: V55A

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128146
Predicted Effect probably damaging
Transcript: ENSMUST00000137201
AA Change: V55A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142264
Predicted Effect unknown
Transcript: ENSMUST00000154842
AA Change: V51A
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279
AA Change: V51A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
R8851:Lmf1 UTSW 17 25585706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACTGAAGCCACCACGGAG -3'
(R):5'- AAGTTTAAGCAGCCACTGAGTG -3'

Sequencing Primer
(F):5'- AAGAGGTCCGCGTGTCATC -3'
(R):5'- GTGAGAAGGCGGGGTCC -3'
Posted On2015-10-21