Incidental Mutation 'R4698:Nedd4l'
ID355868
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65203880 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 666 (Y666C)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: Y666C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: Y666C

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: Y787C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: Y787C

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: Y646C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: Y666C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense not run
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTAAAAGGGTTCGCTGG -3'
(R):5'- GTTCACATTCTCAGTATGCACAAG -3'

Sequencing Primer
(F):5'- GCTGGATACTTTCCTGTACACAGAG -3'
(R):5'- AGATGGCTCAATTGCTCAAGTGC -3'
Posted On2015-10-21