Incidental Mutation 'R4698:Loxhd1'
ID355869
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4698 (G1)
Quality Score164
Status Not validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77372291 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 659 (E659G)
Ref Sequence ENSEMBL: ENSMUSP00000114988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]
Predicted Effect probably benign
Transcript: ENSMUST00000035501
AA Change: E745G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818
AA Change: E745G

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096547
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123410
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148341
AA Change: E659G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: E659G

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zbtb10 T C 3: 9,264,550 S323P possibly damaging Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7967:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R8042:Loxhd1 UTSW 18 77431192 missense not run
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGTTTGTGGACACAG -3'
(R):5'- AAGGGACATTGAATCACCCTG -3'

Sequencing Primer
(F):5'- ACCTGGTGGTGCAGGAG -3'
(R):5'- CTTTAAGGGAAAATATAACCCCCTGG -3'
Posted On2015-10-21