Incidental Mutation 'R4700:Zfp142'
ID355879
Institutional Source Beutler Lab
Gene Symbol Zfp142
Ensembl Gene ENSMUSG00000026135
Gene Namezinc finger protein 142
Synonyms9330177B18Rik
MMRRC Submission 041948-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74565127-74588246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74570272 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1352 (F1352L)
Ref Sequence ENSEMBL: ENSMUSP00000109366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000027362] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113747] [ENSMUST00000113749] [ENSMUST00000113750] [ENSMUST00000127921] [ENSMUST00000141412] [ENSMUST00000152707] [ENSMUST00000156613]
Predicted Effect probably damaging
Transcript: ENSMUST00000027315
AA Change: F1455L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135
AA Change: F1455L

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027362
SMART Domains Protein: ENSMUSP00000027362
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066986
AA Change: F1254L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135
AA Change: F1254L

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113737
AA Change: F1352L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135
AA Change: F1352L

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113747
SMART Domains Protein: ENSMUSP00000109376
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113749
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113750
SMART Domains Protein: ENSMUSP00000109379
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 7.16e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135111
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152707
SMART Domains Protein: ENSMUSP00000121732
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189956
Meta Mutation Damage Score 0.1765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc7 T C 5: 106,973,841 F207L probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Nol6 T C 4: 41,118,944 E683G possibly damaging Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Ugt2b36 A T 5: 87,092,442 probably null Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in Zfp142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Zfp142 APN 1 74566972 missense probably damaging 1.00
IGL00711:Zfp142 APN 1 74572434 missense probably damaging 1.00
IGL01391:Zfp142 APN 1 74579540 missense probably damaging 1.00
IGL01808:Zfp142 APN 1 74576025 missense probably damaging 1.00
IGL02074:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02134:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02567:Zfp142 APN 1 74578147 missense possibly damaging 0.84
IGL02567:Zfp142 APN 1 74578149 missense possibly damaging 0.92
IGL02567:Zfp142 APN 1 74578150 missense possibly damaging 0.92
IGL02669:Zfp142 APN 1 74571273 missense probably benign 0.18
IGL02694:Zfp142 APN 1 74570148 missense probably damaging 0.98
IGL02884:Zfp142 APN 1 74571983 missense probably damaging 0.99
IGL03000:Zfp142 APN 1 74573618 missense probably benign 0.01
IGL03080:Zfp142 APN 1 74571209 missense probably benign 0.18
IGL03238:Zfp142 APN 1 74576278 missense probably benign 0.37
IGL03277:Zfp142 APN 1 74571034 missense probably damaging 1.00
PIT4402001:Zfp142 UTSW 1 74579528 missense probably damaging 1.00
R0124:Zfp142 UTSW 1 74568623 missense probably damaging 1.00
R0256:Zfp142 UTSW 1 74578158 missense probably benign
R0267:Zfp142 UTSW 1 74576064 missense probably benign 0.05
R0306:Zfp142 UTSW 1 74570182 missense probably damaging 1.00
R0321:Zfp142 UTSW 1 74569714 missense probably damaging 1.00
R0466:Zfp142 UTSW 1 74585411 missense possibly damaging 0.95
R0513:Zfp142 UTSW 1 74571555 missense probably damaging 1.00
R1084:Zfp142 UTSW 1 74571826 missense probably benign
R1534:Zfp142 UTSW 1 74572088 missense probably benign 0.00
R1548:Zfp142 UTSW 1 74570104 missense probably damaging 1.00
R1623:Zfp142 UTSW 1 74571775 missense possibly damaging 0.56
R1628:Zfp142 UTSW 1 74571888 missense possibly damaging 0.94
R1710:Zfp142 UTSW 1 74572230 missense probably damaging 1.00
R1722:Zfp142 UTSW 1 74569776 missense probably damaging 1.00
R1770:Zfp142 UTSW 1 74579631 missense probably damaging 0.99
R2042:Zfp142 UTSW 1 74570619 missense probably benign 0.10
R2112:Zfp142 UTSW 1 74573636 missense probably damaging 1.00
R2249:Zfp142 UTSW 1 74567032 missense probably damaging 1.00
R4393:Zfp142 UTSW 1 74572060 missense probably benign 0.00
R4750:Zfp142 UTSW 1 74572458 missense probably damaging 1.00
R4763:Zfp142 UTSW 1 74576512 missense probably damaging 1.00
R5208:Zfp142 UTSW 1 74570868 missense probably benign 0.18
R5233:Zfp142 UTSW 1 74585449 missense probably damaging 1.00
R5585:Zfp142 UTSW 1 74578245 nonsense probably null
R6192:Zfp142 UTSW 1 74570508 missense probably damaging 1.00
R6461:Zfp142 UTSW 1 74567185 missense probably damaging 1.00
R6482:Zfp142 UTSW 1 74570217 splice site probably null
R7320:Zfp142 UTSW 1 74570008 nonsense probably null
R7438:Zfp142 UTSW 1 74585520 missense probably benign
R7528:Zfp142 UTSW 1 74570902 missense probably benign 0.00
R7600:Zfp142 UTSW 1 74573668 missense probably damaging 1.00
R8007:Zfp142 UTSW 1 74571496 missense probably benign 0.01
Z1177:Zfp142 UTSW 1 74570166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAAGAGCTGGACGGTTAGG -3'
(R):5'- TGGTACCAACTCAAAACTGCG -3'

Sequencing Primer
(F):5'- TTAGGGAAGGACTCCTGGC -3'
(R):5'- TGCGCTTGCATCAACTACGAG -3'
Posted On2015-10-21