Incidental Mutation 'R4700:E2f1'
ID355889
Institutional Source Beutler Lab
Gene Symbol E2f1
Ensembl Gene ENSMUSG00000027490
Gene NameE2F transcription factor 1
SynonymsE2F-1
MMRRC Submission 041948-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154559407-154569892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 154564022 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 144 (G144R)
Ref Sequence ENSEMBL: ENSMUSP00000099434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000894] [ENSMUST00000103145]
Predicted Effect probably damaging
Transcript: ENSMUST00000000894
AA Change: G99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000894
Gene: ENSMUSG00000027490
AA Change: G99R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:E2F_TDP 77 142 1.1e-25 PFAM
low complexity region 156 173 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103145
AA Change: G144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099434
Gene: ENSMUSG00000027490
AA Change: G144R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
E2F_TDP 122 187 1.63e-30 SMART
Pfam:E2F_CC-MB 201 294 2.2e-37 PFAM
low complexity region 318 340 N/A INTRINSIC
Meta Mutation Damage Score 0.6284 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc7 T C 5: 106,973,841 F207L probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Nol6 T C 4: 41,118,944 E683G possibly damaging Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Ugt2b36 A T 5: 87,092,442 probably null Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp142 A G 1: 74,570,272 F1352L probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in E2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0666:E2f1 UTSW 2 154560929 missense probably benign 0.01
R0674:E2f1 UTSW 2 154564109 missense probably damaging 1.00
R1796:E2f1 UTSW 2 154560929 missense probably benign 0.02
R3747:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3751:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3752:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3753:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3843:E2f1 UTSW 2 154560828 missense probably benign 0.00
R3844:E2f1 UTSW 2 154560828 missense probably benign 0.00
R3968:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3969:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3970:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R4409:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R5396:E2f1 UTSW 2 154564448 missense probably benign 0.00
R5666:E2f1 UTSW 2 154569181 intron probably benign
R6368:E2f1 UTSW 2 154564476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGACCTTGGTTTCCCAGCTG -3'
(R):5'- TCTACATTGCTAGGGAGACAGG -3'

Sequencing Primer
(F):5'- GCCACTGCAAGCAATTTGG -3'
(R):5'- CTAGGGAGACAGGCCTGTTG -3'
Posted On2015-10-21