Incidental Mutation 'R4700:Nol6'
ID355894
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Namenucleolar protein family 6 (RNA-associated)
SynonymsNrap
MMRRC Submission 041948-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41114427-41124455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41118944 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 683 (E683G)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030138
AA Change: E683G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: E683G

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155315
Meta Mutation Damage Score 0.1061 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc7 T C 5: 106,973,841 F207L probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Ugt2b36 A T 5: 87,092,442 probably null Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp142 A G 1: 74,570,272 F1352L probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41123374 missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41122198 missense probably benign 0.10
IGL01062:Nol6 APN 4 41118205 missense probably benign 0.13
IGL01113:Nol6 APN 4 41115749 missense probably damaging 1.00
IGL01874:Nol6 APN 4 41115412 missense probably damaging 1.00
IGL01995:Nol6 APN 4 41118567 missense probably damaging 1.00
IGL02060:Nol6 APN 4 41117700 missense probably damaging 1.00
IGL03082:Nol6 APN 4 41115878 splice site probably benign
IGL03221:Nol6 APN 4 41124166 missense probably benign 0.00
IGL03332:Nol6 APN 4 41120735 missense probably damaging 1.00
leaky UTSW 4 41118154 missense probably benign 0.02
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0308:Nol6 UTSW 4 41123584 missense probably benign 0.01
R0632:Nol6 UTSW 4 41121115 missense probably damaging 0.96
R1222:Nol6 UTSW 4 41120760 missense probably benign 0.01
R1471:Nol6 UTSW 4 41120281 missense probably benign 0.00
R1481:Nol6 UTSW 4 41123596 missense probably benign 0.00
R1971:Nol6 UTSW 4 41119542 missense probably damaging 1.00
R2191:Nol6 UTSW 4 41118720 missense probably benign 0.00
R2495:Nol6 UTSW 4 41118427 missense probably damaging 1.00
R3852:Nol6 UTSW 4 41117452 missense probably damaging 0.99
R3923:Nol6 UTSW 4 41121531 missense probably benign 0.17
R4458:Nol6 UTSW 4 41115888 missense probably damaging 1.00
R4510:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4511:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4575:Nol6 UTSW 4 41120299 missense probably benign 0.00
R4637:Nol6 UTSW 4 41121788 missense probably damaging 0.99
R4820:Nol6 UTSW 4 41121508 missense probably damaging 1.00
R4975:Nol6 UTSW 4 41120167 missense probably benign 0.00
R5395:Nol6 UTSW 4 41118392 intron probably benign
R5826:Nol6 UTSW 4 41122158 missense probably benign 0.04
R6531:Nol6 UTSW 4 41118154 missense probably benign 0.02
R6943:Nol6 UTSW 4 41118962 missense probably damaging 1.00
R7001:Nol6 UTSW 4 41121279 missense probably benign 0.00
R7035:Nol6 UTSW 4 41118479 missense probably benign 0.01
R7282:Nol6 UTSW 4 41119468 missense probably benign 0.18
R7327:Nol6 UTSW 4 41116686 missense probably benign 0.34
R7402:Nol6 UTSW 4 41118699 missense probably damaging 1.00
R7483:Nol6 UTSW 4 41117424 missense possibly damaging 0.92
R7505:Nol6 UTSW 4 41120352 missense probably damaging 1.00
R7669:Nol6 UTSW 4 41118717 missense probably damaging 0.97
R8255:Nol6 UTSW 4 41120168 missense probably benign 0.01
R8401:Nol6 UTSW 4 41119548 missense possibly damaging 0.87
R8426:Nol6 UTSW 4 41119870 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAGCTCTTGGAGGCGGTTATAG -3'
(R):5'- TGCCATAGCCTGAATCATGGC -3'

Sequencing Primer
(F):5'- CTCTTGGAGGCGGTTATAGAAGGAG -3'
(R):5'- TAGCCTGAATCATGGCAGCATC -3'
Posted On2015-10-21