Incidental Mutation 'R4700:Ugt2b36'
ID355902
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission 041948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87065927-87092555 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 87092442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000132667] [ENSMUST00000145617]
Predicted Effect probably damaging
Transcript: ENSMUST00000094649
AA Change: V28E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: V28E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132667
AA Change: V28E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123024
Gene: ENSMUSG00000070704
AA Change: V28E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 105 1.1e-23 PFAM
Pfam:UDPGT 99 265 7.4e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145617
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154455
SMART Domains Protein: ENSMUSP00000120633
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 1 198 1.2e-117 PFAM
Pfam:Glyco_tran_28_C 109 194 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199725
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc7 T C 5: 106,973,841 F207L probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Nol6 T C 4: 41,118,944 E683G possibly damaging Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp142 A G 1: 74,570,272 F1352L probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87081581 missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87080869 critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87080885 missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87090942 missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87080924 missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87090900 missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87092074 missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87091975 missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87089477 missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87066375 missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87091989 missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87092071 missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87092399 missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87081581 missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87080868 critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2066:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87066255 missense possibly damaging 0.65
R2696:Ugt2b36 UTSW 5 87089485 missense probably damaging 1.00
R4626:Ugt2b36 UTSW 5 87092088 missense probably damaging 1.00
R4731:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4732:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4733:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4922:Ugt2b36 UTSW 5 87066324 missense probably damaging 1.00
R5217:Ugt2b36 UTSW 5 87066255 missense probably damaging 0.97
R5244:Ugt2b36 UTSW 5 87091906 missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87092228 nonsense probably null
R5478:Ugt2b36 UTSW 5 87089482 missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87089482 missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87092438 nonsense probably null
R5961:Ugt2b36 UTSW 5 87080865 splice site probably null
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87092171 missense probably benign
R6145:Ugt2b36 UTSW 5 87066213 missense probably benign
R6226:Ugt2b36 UTSW 5 87092130 missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87081586 missense probably damaging 1.00
R6704:Ugt2b36 UTSW 5 87092131 missense probably damaging 1.00
R6895:Ugt2b36 UTSW 5 87092298 missense probably benign 0.06
R7218:Ugt2b36 UTSW 5 87081539 missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87080903 missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87066279 missense possibly damaging 0.94
R7650:Ugt2b36 UTSW 5 87080972 missense probably damaging 1.00
R7707:Ugt2b36 UTSW 5 87081508 critical splice donor site probably null
R7866:Ugt2b36 UTSW 5 87092331 missense probably damaging 1.00
R7949:Ugt2b36 UTSW 5 87092331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTCATAAGTCCATCTTTCCAC -3'
(R):5'- CACCAACACAGTAATGTTCATTTCC -3'

Sequencing Primer
(F):5'- CACAGCCTTTGCAAAAATAATTTCC -3'
(R):5'- ATGTTCATTTCCTTATCAGCTTTGAG -3'
Posted On2015-10-21