Incidental Mutation 'R4700:Cdc7'
ID355903
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Namecell division cycle 7 (S. cerevisiae)
SynonymsCdc7, muCdc7, Cdc7l1
MMRRC Submission 041948-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106964322-106984432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106973841 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 207 (F207L)
Ref Sequence ENSEMBL: ENSMUSP00000075792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
Predicted Effect probably benign
Transcript: ENSMUST00000031221
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283
AA Change: F207L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076467
AA Change: F207L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283
AA Change: F207L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283
AA Change: F207L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118261
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283
AA Change: F207L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123546
Predicted Effect probably benign
Transcript: ENSMUST00000129938
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283
AA Change: F207L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199223
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Nol6 T C 4: 41,118,944 E683G possibly damaging Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Ugt2b36 A T 5: 87,092,442 probably null Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp142 A G 1: 74,570,272 F1352L probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R3112:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6258:Cdc7 UTSW 5 106969227 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
R6609:Cdc7 UTSW 5 106973058 missense probably benign 0.04
R7828:Cdc7 UTSW 5 106972950 missense possibly damaging 0.67
R8518:Cdc7 UTSW 5 106972998 missense probably damaging 1.00
V8831:Cdc7 UTSW 5 106968910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGCCTTAGCTCTTAAGTAC -3'
(R):5'- AAAGCTAGAACCTTTCCGTCTTTTC -3'

Sequencing Primer
(F):5'- CGGCCTTAGCTCTTAAGTACTTGGG -3'
(R):5'- TCCTTGCTTAATGTGAACTTGTG -3'
Posted On2015-10-21