Incidental Mutation 'R4700:Mylk'
ID 355975
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 041948-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4700 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34742805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1106 (V1106L)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: V1106L

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V1106L

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Meta Mutation Damage Score 0.2261 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,742,795 (GRCm39) probably benign Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abca14 T A 7: 119,911,928 (GRCm39) probably null Het
Abca8a A C 11: 109,961,308 (GRCm39) V538G probably damaging Het
Acy1 C T 9: 106,310,782 (GRCm39) G329R probably benign Het
Adamts17 T C 7: 66,691,636 (GRCm39) C607R probably damaging Het
Adamts20 A T 15: 94,292,503 (GRCm39) C202* probably null Het
Adcy5 A G 16: 35,099,586 (GRCm39) N712S possibly damaging Het
Ahnak A G 19: 8,982,045 (GRCm39) K1110E probably benign Het
Anks6 T A 4: 47,033,127 (GRCm39) H578L possibly damaging Het
Appl1 C A 14: 26,647,928 (GRCm39) L626F probably benign Het
Arl1 A G 10: 88,566,499 (GRCm39) probably benign Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Carm1 A G 9: 21,498,480 (GRCm39) N466S probably benign Het
Cbl A G 9: 44,084,677 (GRCm39) S153P probably damaging Het
Ccdc159 A G 9: 21,839,027 (GRCm39) probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc7 T C 5: 107,121,707 (GRCm39) F207L probably benign Het
Celsr2 T C 3: 108,304,547 (GRCm39) R2271G probably benign Het
Cep162 T C 9: 87,088,915 (GRCm39) Q989R probably damaging Het
Cep89 A G 7: 35,137,862 (GRCm39) T749A probably benign Het
Clcn5 T C X: 7,032,591 (GRCm39) probably null Het
Clu A T 14: 66,217,313 (GRCm39) Y382F probably benign Het
Cnih4 A G 1: 180,993,808 (GRCm39) probably benign Het
Crb1 A G 1: 139,126,509 (GRCm39) L1340P probably damaging Het
Ddx4 T C 13: 112,750,269 (GRCm39) T421A probably damaging Het
Dennd5a T C 7: 109,520,405 (GRCm39) E484G probably benign Het
Dsg4 G T 18: 20,589,965 (GRCm39) V372L possibly damaging Het
Dyrk2 T C 10: 118,704,191 (GRCm39) D21G probably benign Het
E2f1 C G 2: 154,405,942 (GRCm39) G144R probably damaging Het
Epb41l4a A T 18: 33,935,560 (GRCm39) probably null Het
F10 G T 8: 13,089,621 (GRCm39) V67F possibly damaging Het
Fat3 A G 9: 15,942,469 (GRCm39) I1301T probably damaging Het
Filip1l A G 16: 57,391,058 (GRCm39) T549A probably benign Het
Flt4 C A 11: 49,517,271 (GRCm39) probably benign Het
Fndc1 G A 17: 7,990,312 (GRCm39) T1128I unknown Het
Fos T C 12: 85,522,936 (GRCm39) S283P probably benign Het
Fryl T C 5: 73,222,881 (GRCm39) Y1900C possibly damaging Het
Fsip2 C A 2: 82,817,373 (GRCm39) Q4369K probably benign Het
Gad2 A T 2: 22,563,982 (GRCm39) H395L probably damaging Het
Grm2 T A 9: 106,531,130 (GRCm39) I120F probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Igsf10 A T 3: 59,227,751 (GRCm39) I1974N probably damaging Het
Il23r T C 6: 67,450,834 (GRCm39) N215S probably damaging Het
Jph1 T A 1: 17,161,928 (GRCm39) M245L possibly damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lsg1 A G 16: 30,384,267 (GRCm39) I521T probably damaging Het
Ltc4s C T 11: 50,127,908 (GRCm39) G83R probably damaging Het
Map2 A G 1: 66,449,796 (GRCm39) E173G probably damaging Het
Med29 T A 7: 28,086,352 (GRCm39) D152V possibly damaging Het
Megf8 A G 7: 25,062,940 (GRCm39) D2432G probably damaging Het
Mrpl38 G A 11: 116,025,978 (GRCm39) probably benign Het
Myh7 A G 14: 55,225,778 (GRCm39) I521T possibly damaging Het
Myo15b A T 11: 115,752,761 (GRCm39) D753V possibly damaging Het
Myo1g T C 11: 6,466,785 (GRCm39) probably null Het
Myrfl A G 10: 116,613,247 (GRCm39) probably null Het
Naip5 A G 13: 100,359,922 (GRCm39) V438A possibly damaging Het
Nav3 A G 10: 109,600,796 (GRCm39) V1277A probably benign Het
Nek10 T A 14: 14,842,841 (GRCm38) V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 (GRCm38) V355A probably benign Het
Nol6 T C 4: 41,118,944 (GRCm39) E683G possibly damaging Het
Obsl1 A T 1: 75,480,085 (GRCm39) V487E probably damaging Het
Oc90 T A 15: 65,753,354 (GRCm39) R322W possibly damaging Het
Or1q1 C A 2: 36,887,515 (GRCm39) A231D probably benign Het
Or4f60 A G 2: 111,902,097 (GRCm39) V277A possibly damaging Het
Or52e4 A T 7: 104,705,483 (GRCm39) H10L possibly damaging Het
Or8b4 A G 9: 37,830,217 (GRCm39) E93G possibly damaging Het
Osbp2 T C 11: 3,662,160 (GRCm39) H231R probably damaging Het
Pate6 A T 9: 35,701,021 (GRCm39) C22S probably damaging Het
Pdzph1 T C 17: 59,281,541 (GRCm39) H247R probably damaging Het
Pidd1 T C 7: 141,022,162 (GRCm39) N209S probably damaging Het
Pknox1 C T 17: 31,822,286 (GRCm39) A351V probably damaging Het
Plxnd1 C A 6: 115,935,576 (GRCm39) V1737F probably damaging Het
Prkdc A T 16: 15,519,976 (GRCm39) K1138M probably damaging Het
Rad54l2 T C 9: 106,631,224 (GRCm39) D21G possibly damaging Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Scgb2b6 T C 7: 31,318,908 (GRCm39) noncoding transcript Het
Sdc1 A G 12: 8,840,541 (GRCm39) E106G possibly damaging Het
Slc10a5 T G 3: 10,400,360 (GRCm39) Q100P probably damaging Het
Slc10a5 C A 3: 10,400,359 (GRCm39) Q100H probably damaging Het
Slc5a9 A T 4: 111,748,134 (GRCm39) L226Q possibly damaging Het
Slfn1 T C 11: 83,012,475 (GRCm39) V197A probably benign Het
Spire1 T C 18: 67,645,935 (GRCm39) M244V probably benign Het
St3gal3 C T 4: 117,817,232 (GRCm39) V141I probably benign Het
St6galnac4 G T 2: 32,477,172 (GRCm39) probably benign Het
Svep1 T C 4: 58,097,323 (GRCm39) K1407E possibly damaging Het
Tbc1d32 A G 10: 56,100,745 (GRCm39) C78R probably damaging Het
Tcstv5 T C 13: 120,411,378 (GRCm39) Y76C probably benign Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmeff1 A T 4: 48,636,869 (GRCm39) Y189F possibly damaging Het
Tmem131l C T 3: 83,806,519 (GRCm39) A1433T probably benign Het
Tnfrsf8 T C 4: 145,029,692 (GRCm39) Y36C probably damaging Het
Trp53i11 G T 2: 93,030,245 (GRCm39) R184L probably damaging Het
Trpv1 A T 11: 73,142,110 (GRCm39) M214L possibly damaging Het
Tsnax T A 8: 125,755,533 (GRCm39) S132T probably benign Het
Ttc28 T C 5: 111,424,909 (GRCm39) L1547P probably damaging Het
Ttc3 A G 16: 94,240,100 (GRCm39) probably null Het
Tubal3 T A 13: 3,983,514 (GRCm39) D431E probably damaging Het
Ugt2b36 A T 5: 87,240,301 (GRCm39) probably null Het
Vmn1r23 A T 6: 57,903,190 (GRCm39) I196K probably benign Het
Vmn1r55 A C 7: 5,149,586 (GRCm39) L279R probably damaging Het
Vmn1r55 G T 7: 5,149,587 (GRCm39) L279M probably damaging Het
Vmn2r89 G A 14: 51,694,942 (GRCm39) G474E probably damaging Het
Vps26b T C 9: 26,926,511 (GRCm39) K163E probably damaging Het
Zfp142 A G 1: 74,609,431 (GRCm39) F1352L probably damaging Het
Zfp422 C T 6: 116,603,844 (GRCm39) E52K possibly damaging Het
Zfp423 T A 8: 88,508,338 (GRCm39) probably null Het
Zfp493 T C 13: 67,934,736 (GRCm39) F230L probably damaging Het
Zfp760 T C 17: 21,941,388 (GRCm39) C188R probably benign Het
Zfyve28 G T 5: 34,375,189 (GRCm39) T275K probably damaging Het
Znhit3 T C 11: 84,807,155 (GRCm39) N5D probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTAATGCCAAGCCTACCGAGAC -3'
(R):5'- GTGTCTTCCCATTCAGCGAC -3'

Sequencing Primer
(F):5'- TACCGAGACCCTGAAGCCTG -3'
(R):5'- ACCAGGTGACAGTGGCG -3'
Posted On 2015-10-21