Incidental Mutation 'R4701:Cfap65'
ID 355989
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74958067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 947 (D947G)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: D947G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: D947G

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.3500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTGCCTGACCCATAGTATG -3'
(R):5'- AGGACAAGATACGGATCCTTGC -3'

Sequencing Primer
(F):5'- TGGGCCATCTATCTTAAGCACAG -3'
(R):5'- GATACGGATCCTTGCACCCC -3'
Posted On 2015-10-21