Incidental Mutation 'R4701:Kdm5b'
ID 355991
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 134533750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112197
SMART Domains Protein: ENSMUSP00000107816
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 225 236 N/A INTRINSIC
PHD 308 354 6.15e-14 SMART
JmjC 450 595 2.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGTGACCATCATGAACCC -3'
(R):5'- ACAAAACTTACAGGGGCTGG -3'

Sequencing Primer
(F):5'- CCAACACTCTGATGACTCATGAAGTG -3'
(R):5'- GATGAAATCTGATGCCCTGTTC -3'
Posted On 2015-10-21