Incidental Mutation 'R4701:Fmn1'
ID 355997
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Name formin 1
Synonyms formin-1, Fmn
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 113158081-113547112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113414416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 895 (Y895F)
Ref Sequence ENSEMBL: ENSMUSP00000080093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
AlphaFold Q05860
PDB Structure FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081349
AA Change: Y895F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: Y895F

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099576
AA Change: Y1121F

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: Y1121F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102547
AA Change: Y1121F

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: Y1121F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161731
AA Change: Y1023F

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: Y1023F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: Y970F
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113,274,812 (GRCm39) intron probably benign
IGL01520:Fmn1 APN 2 113,274,713 (GRCm39) intron probably benign
IGL02039:Fmn1 APN 2 113,195,425 (GRCm39) missense unknown
IGL02222:Fmn1 APN 2 113,423,454 (GRCm39) missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113,412,470 (GRCm39) missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113,194,471 (GRCm39) missense unknown
IGL02490:Fmn1 APN 2 113,359,817 (GRCm39) splice site probably benign
IGL02506:Fmn1 APN 2 113,355,640 (GRCm39) missense unknown
IGL02684:Fmn1 APN 2 113,355,622 (GRCm39) missense unknown
IGL03008:Fmn1 APN 2 113,195,445 (GRCm39) missense unknown
IGL03058:Fmn1 APN 2 113,272,159 (GRCm39) intron probably benign
IGL03076:Fmn1 APN 2 113,414,437 (GRCm39) missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113,356,128 (GRCm39) small insertion probably benign
FR4304:Fmn1 UTSW 2 113,356,119 (GRCm39) small insertion probably benign
FR4342:Fmn1 UTSW 2 113,356,128 (GRCm39) small insertion probably benign
FR4589:Fmn1 UTSW 2 113,356,119 (GRCm39) small insertion probably benign
FR4589:Fmn1 UTSW 2 113,356,118 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,129 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,126 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,123 (GRCm39) small insertion probably benign
R0349:Fmn1 UTSW 2 113,196,141 (GRCm39) missense unknown
R0452:Fmn1 UTSW 2 113,467,124 (GRCm39) missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113,538,198 (GRCm39) splice site probably benign
R1215:Fmn1 UTSW 2 113,523,375 (GRCm39) nonsense probably null
R1471:Fmn1 UTSW 2 113,523,439 (GRCm39) missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113,195,557 (GRCm39) missense unknown
R1491:Fmn1 UTSW 2 113,426,714 (GRCm39) missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113,356,207 (GRCm39) missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113,523,463 (GRCm39) missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113,196,043 (GRCm39) missense unknown
R1602:Fmn1 UTSW 2 113,355,968 (GRCm39) missense unknown
R1690:Fmn1 UTSW 2 113,355,827 (GRCm39) missense unknown
R1772:Fmn1 UTSW 2 113,195,700 (GRCm39) missense unknown
R1867:Fmn1 UTSW 2 113,539,783 (GRCm39) missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113,260,066 (GRCm39) intron probably benign
R1941:Fmn1 UTSW 2 113,195,488 (GRCm39) missense unknown
R2019:Fmn1 UTSW 2 113,194,825 (GRCm39) missense unknown
R2140:Fmn1 UTSW 2 113,425,393 (GRCm39) missense probably benign 0.45
R2164:Fmn1 UTSW 2 113,195,962 (GRCm39) missense unknown
R2395:Fmn1 UTSW 2 113,195,526 (GRCm39) missense unknown
R2999:Fmn1 UTSW 2 113,195,439 (GRCm39) missense unknown
R3405:Fmn1 UTSW 2 113,194,693 (GRCm39) missense unknown
R3407:Fmn1 UTSW 2 113,195,400 (GRCm39) missense unknown
R3771:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113,195,467 (GRCm39) missense unknown
R4166:Fmn1 UTSW 2 113,467,080 (GRCm39) missense probably benign 0.33
R4477:Fmn1 UTSW 2 113,274,744 (GRCm39) intron probably benign
R4614:Fmn1 UTSW 2 113,195,494 (GRCm39) missense unknown
R4867:Fmn1 UTSW 2 113,414,465 (GRCm39) critical splice donor site probably null
R5063:Fmn1 UTSW 2 113,195,266 (GRCm39) missense unknown
R5224:Fmn1 UTSW 2 113,195,470 (GRCm39) missense unknown
R5510:Fmn1 UTSW 2 113,426,714 (GRCm39) missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113,194,648 (GRCm39) missense unknown
R6234:Fmn1 UTSW 2 113,196,000 (GRCm39) missense unknown
R6266:Fmn1 UTSW 2 113,426,683 (GRCm39) missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113,355,560 (GRCm39) missense unknown
R7054:Fmn1 UTSW 2 113,195,353 (GRCm39) missense unknown
R7311:Fmn1 UTSW 2 113,356,025 (GRCm39) missense unknown
R7439:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7440:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7441:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7444:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7461:Fmn1 UTSW 2 113,194,416 (GRCm39) missense unknown
R7526:Fmn1 UTSW 2 113,518,479 (GRCm39) missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113,359,655 (GRCm39) splice site probably null
R7576:Fmn1 UTSW 2 113,195,353 (GRCm39) missense unknown
R7657:Fmn1 UTSW 2 113,355,538 (GRCm39) missense unknown
R7669:Fmn1 UTSW 2 113,195,822 (GRCm39) missense unknown
R7713:Fmn1 UTSW 2 113,356,159 (GRCm39) missense unknown
R7841:Fmn1 UTSW 2 113,359,810 (GRCm39) critical splice donor site probably null
R7953:Fmn1 UTSW 2 113,426,689 (GRCm39) missense probably benign 0.03
R7959:Fmn1 UTSW 2 113,195,967 (GRCm39) missense unknown
R8041:Fmn1 UTSW 2 113,194,939 (GRCm39) missense unknown
R8152:Fmn1 UTSW 2 113,196,037 (GRCm39) missense unknown
R8203:Fmn1 UTSW 2 113,355,620 (GRCm39) missense unknown
R8318:Fmn1 UTSW 2 113,195,502 (GRCm39) missense unknown
R8356:Fmn1 UTSW 2 113,195,385 (GRCm39) missense unknown
R8456:Fmn1 UTSW 2 113,195,385 (GRCm39) missense unknown
R8698:Fmn1 UTSW 2 113,260,152 (GRCm39) missense unknown
R8861:Fmn1 UTSW 2 113,195,149 (GRCm39) missense unknown
R8907:Fmn1 UTSW 2 113,355,914 (GRCm39) missense unknown
R9147:Fmn1 UTSW 2 113,271,973 (GRCm39) missense unknown
R9148:Fmn1 UTSW 2 113,271,973 (GRCm39) missense unknown
R9536:Fmn1 UTSW 2 113,309,262 (GRCm39) missense unknown
R9574:Fmn1 UTSW 2 113,425,402 (GRCm39) missense probably damaging 1.00
R9577:Fmn1 UTSW 2 113,194,470 (GRCm39) missense unknown
RF003:Fmn1 UTSW 2 113,356,131 (GRCm39) small insertion probably benign
Z1088:Fmn1 UTSW 2 113,272,270 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- ACCATTTGCTTTAGCTGGTAAATGC -3'
(R):5'- ACGCTGTTGTAACTCAGCC -3'

Sequencing Primer
(F):5'- GCTTTAGCTGGTAAATGCCAAGC -3'
(R):5'- GTTGTAACTCAGCCCTCTACG -3'
Posted On 2015-10-21