Mutagenetix > Incidental Mutation

Incidental Mutation 'R4701:Stard9'

355998

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

041949-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 120705713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 345 (R345Q)

Ref Sequence

ENSEMBL: ENSMUSP00000116900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070420

SMART Domains

Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
coiled coil region	97	138	N/A	INTRINSIC
low complexity region	142	151	N/A	INTRINSIC
low complexity region	157	174	N/A	INTRINSIC
low complexity region	234	255	N/A	INTRINSIC
Pfam:START	274	469	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154193
AA Change: R345Q

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: R345Q

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000180041
AA Change: R4121Q

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: R4121Q

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCATGGTTTTGGGGAGACAG -3'
(R):5'- GATGGTCAACTTCCAGCCAG -3'

Sequencing Primer
(F):5'- GAGACAGATGCCCTGCTCAAG -3'
(R):5'- ACAGAGCCTGCTTCCTCAG -3'

Posted On

2015-10-21