Incidental Mutation 'R4701:Rorc'
ID356004
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene NameRAR-related orphan receptor gamma
SynonymsThor, thymus orphan receptor, RORgamma
MMRRC Submission 041949-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94372794-94398276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 94391710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 391 (E391Q)
Ref Sequence ENSEMBL: ENSMUSP00000143763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably null
Transcript: ENSMUST00000029795
AA Change: E412Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: E412Q

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197040
AA Change: E391Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150
AA Change: E391Q

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Predicted Effect probably benign
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Meta Mutation Damage Score 0.2215 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
R7730:Rorc UTSW 3 94393114 missense probably benign 0.43
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGCCTCTCTACATGGTTG -3'
(R):5'- ATCCTCGCCCTGTCTTAAGG -3'

Sequencing Primer
(F):5'- AAGCCTCTCTACATGGTTGTTTGC -3'
(R):5'- TTTTACAGAAGCACGGGATAGAGCTC -3'
Posted On2015-10-21