Incidental Mutation 'R4701:Ppp1r3a'
ID 356016
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14718992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 641 (T641A)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: T641A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: T641A

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGACGCGCTTTCTGGAGTAC -3'
(R):5'- GCAATTTAGAACCAGGAACTAGTG -3'

Sequencing Primer
(F):5'- GCTTTCTCAGTAATACCATGATCAGC -3'
(R):5'- CCAGGAACTAGTGATCTTAGTTCTC -3'
Posted On 2015-10-21