Mutagenetix > Incidental Mutation

Incidental Mutation 'R4701:Plxna4'

356017

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

041949-MU

Accession Numbers

Genbank: NM_175750

Essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32516688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 331 (D331G)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000115096
AA Change: D331G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: D331G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150314

Meta Mutation Damage Score

0.6358

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9269:Plxna4	UTSW	6	32178380	missense	probably benign	0.00
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
R9469:Plxna4	UTSW	6	32517591	missense	probably benign
R9583:Plxna4	UTSW	6	32215234	missense	possibly damaging	0.78
R9647:Plxna4	UTSW	6	32251109	missense	probably damaging	1.00
R9695:Plxna4	UTSW	6	32206121	missense	probably benign	0.02
R9801:Plxna4	UTSW	6	32163591	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCTTCACCTTGAGCCAG -3'
(R):5'- TTTTGACCCTTCAGCCAGAG -3'

Sequencing Primer
(F):5'- AGGCCAGGTCTAGTGTTCC -3'
(R):5'- CTTCAGCCAGAGATGGTGTC -3'

Posted On

2015-10-21