Incidental Mutation 'R4701:Cd22'
ID 356024
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb8, Lyb-8
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30564829-30579767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30575578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 155 (I155F)
Ref Sequence ENSEMBL: ENSMUSP00000140528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000188157] [ENSMUST00000190617] [ENSMUST00000189718] [ENSMUST00000190646] [ENSMUST00000214289] [ENSMUST00000190753]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000019248
AA Change: I155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108125
AA Change: I155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186154
AA Change: I155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187585
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000188157
SMART Domains Protein: ENSMUSP00000140450
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190617
AA Change: I155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189718
AA Change: I155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190646
AA Change: I155F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577
AA Change: I155F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190170
Predicted Effect unknown
Transcript: ENSMUST00000214289
AA Change: I155F
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably benign
Transcript: ENSMUST00000190753
Meta Mutation Damage Score 0.8697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30,575,572 (GRCm39) missense probably benign 0.01
IGL02236:Cd22 APN 7 30,566,893 (GRCm39) missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30,569,308 (GRCm39) missense probably damaging 1.00
IGL02335:Cd22 APN 7 30,575,559 (GRCm39) missense probably damaging 1.00
IGL02397:Cd22 APN 7 30,577,050 (GRCm39) missense probably benign
IGL02402:Cd22 APN 7 30,576,955 (GRCm39) missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30,576,985 (GRCm39) missense probably benign 0.40
IGL02736:Cd22 APN 7 30,577,470 (GRCm39) splice site probably null
blitz UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
crullers UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
gansu UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
lacrima UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
Lluvia UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
Mist UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
rain UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
well UTSW 7 30,577,212 (GRCm39) nonsense probably null
Yosemite UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
FR4304:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30,577,224 (GRCm39) missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30,566,533 (GRCm39) splice site probably benign
R0130:Cd22 UTSW 7 30,569,389 (GRCm39) missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
R1245:Cd22 UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
R1332:Cd22 UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30,572,595 (GRCm39) missense probably benign 0.07
R1716:Cd22 UTSW 7 30,577,103 (GRCm39) missense probably damaging 1.00
R1980:Cd22 UTSW 7 30,572,658 (GRCm39) missense probably damaging 1.00
R2017:Cd22 UTSW 7 30,572,205 (GRCm39) missense probably damaging 0.99
R2061:Cd22 UTSW 7 30,575,581 (GRCm39) missense probably benign 0.03
R2061:Cd22 UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
R2075:Cd22 UTSW 7 30,569,123 (GRCm39) missense probably damaging 1.00
R2216:Cd22 UTSW 7 30,566,471 (GRCm39) missense probably damaging 1.00
R3886:Cd22 UTSW 7 30,569,532 (GRCm39) missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30,575,325 (GRCm39) missense probably damaging 0.98
R4796:Cd22 UTSW 7 30,572,381 (GRCm39) splice site probably null
R5179:Cd22 UTSW 7 30,575,299 (GRCm39) missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
R5456:Cd22 UTSW 7 30,575,464 (GRCm39) missense probably benign 0.02
R5511:Cd22 UTSW 7 30,569,496 (GRCm39) missense probably damaging 1.00
R5513:Cd22 UTSW 7 30,566,450 (GRCm39) missense probably damaging 0.99
R5611:Cd22 UTSW 7 30,577,575 (GRCm39) unclassified probably benign
R5656:Cd22 UTSW 7 30,569,198 (GRCm39) missense probably damaging 1.00
R5966:Cd22 UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
R6329:Cd22 UTSW 7 30,577,193 (GRCm39) missense probably damaging 0.99
R6356:Cd22 UTSW 7 30,577,127 (GRCm39) missense probably damaging 1.00
R6455:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R6550:Cd22 UTSW 7 30,576,977 (GRCm39) missense probably benign 0.00
R6656:Cd22 UTSW 7 30,577,182 (GRCm39) missense probably benign 0.11
R6688:Cd22 UTSW 7 30,572,389 (GRCm39) missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30,572,856 (GRCm39) splice site probably null
R6957:Cd22 UTSW 7 30,566,999 (GRCm39) missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30,577,504 (GRCm39) missense probably benign 0.03
R7083:Cd22 UTSW 7 30,567,473 (GRCm39) missense probably damaging 0.99
R7225:Cd22 UTSW 7 30,577,059 (GRCm39) missense not run
R7732:Cd22 UTSW 7 30,569,482 (GRCm39) missense probably damaging 1.00
R8686:Cd22 UTSW 7 30,569,494 (GRCm39) missense probably benign 0.03
R8851:Cd22 UTSW 7 30,577,084 (GRCm39) missense probably benign 0.01
R8987:Cd22 UTSW 7 30,577,172 (GRCm39) missense probably damaging 1.00
R9051:Cd22 UTSW 7 30,575,449 (GRCm39) missense probably benign
R9098:Cd22 UTSW 7 30,567,391 (GRCm39) missense probably benign 0.00
R9124:Cd22 UTSW 7 30,572,662 (GRCm39) missense probably benign 0.01
R9167:Cd22 UTSW 7 30,575,430 (GRCm39) missense probably benign 0.07
R9319:Cd22 UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
R9369:Cd22 UTSW 7 30,576,999 (GRCm39) missense probably benign 0.09
X0025:Cd22 UTSW 7 30,572,844 (GRCm39) splice site probably null
Z1176:Cd22 UTSW 7 30,568,955 (GRCm39) missense probably damaging 1.00
Z1176:Cd22 UTSW 7 30,567,388 (GRCm39) missense probably benign 0.03
Z1186:Cd22 UTSW 7 30,566,891 (GRCm39) missense probably benign
Z1186:Cd22 UTSW 7 30,566,478 (GRCm39) missense probably benign 0.01
Z1186:Cd22 UTSW 7 30,575,292 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGGTGAGCTTGCTCTCTG -3'
(R):5'- AATTTCCCAGCAGGCTTGTG -3'

Sequencing Primer
(F):5'- AAGGTGAGCTTGCTCTCTGTATAGAC -3'
(R):5'- AGCAGGCTTGTGTTCCCAAG -3'
Posted On 2015-10-21