Mutagenetix > Incidental Mutation

Incidental Mutation 'R4701:Trpm1'

356029

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

041949-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 64243500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1033 (L1033F)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: L1033F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L1033F

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107519
AA Change: L917F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: L917F

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
low complexity region	505	534	N/A	INTRINSIC
low complexity region	707	719	N/A	INTRINSIC
transmembrane domain	760	779	N/A	INTRINSIC
Pfam:Ion_trans	791	1004	1.3e-15	PFAM
transmembrane domain	1034	1051	N/A	INTRINSIC
low complexity region	1100	1109	N/A	INTRINSIC
PDB:3E7K\|H	1112	1163	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: L917F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: L1033F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAAGGCAACAGGGTTCTGG -3'
(R):5'- CTTCCAAATTAATGAGCACTCTTCC -3'

Sequencing Primer
(F):5'- GGGGAAAGCTTGCTTCATCATAAC -3'
(R):5'- TGAGCACTCTTCCATTAATTTGG -3'

Posted On

2015-10-21