Incidental Mutation 'R4701:Sall1'
ID356041
Institutional Source Beutler Lab
Gene Symbol Sall1
Ensembl Gene ENSMUSG00000031665
Gene Namespalt like transcription factor 1
SynonymsMsal-3
MMRRC Submission 041949-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location89027235-89044162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89031160 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 772 (K772M)
Ref Sequence ENSEMBL: ENSMUSP00000034090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034090]
Predicted Effect probably damaging
Transcript: ENSMUST00000034090
AA Change: K772M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: K772M

DomainStartEndE-ValueType
low complexity region 133 152 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 229 257 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
low complexity region 361 396 N/A INTRINSIC
ZnF_C2H2 450 472 2.57e-3 SMART
ZnF_C2H2 478 500 3.21e-4 SMART
low complexity region 547 569 N/A INTRINSIC
ZnF_C2H2 705 727 3.02e0 SMART
ZnF_C2H2 733 755 8.6e-5 SMART
ZnF_C2H2 765 787 1.6e-4 SMART
low complexity region 842 861 N/A INTRINSIC
ZnF_C2H2 1000 1022 2.91e-2 SMART
ZnF_C2H2 1028 1050 4.94e-5 SMART
ZnF_C2H2 1133 1155 1.38e-3 SMART
ZnF_C2H2 1161 1183 1.22e-4 SMART
low complexity region 1257 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.5621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Sall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sall1 APN 8 89033344 missense probably damaging 1.00
IGL01670:Sall1 APN 8 89031571 missense probably benign 0.01
IGL01795:Sall1 APN 8 89028680 missense probably benign 0.02
IGL02041:Sall1 APN 8 89031469 missense probably damaging 1.00
IGL02078:Sall1 APN 8 89030375 missense probably damaging 0.99
IGL02105:Sall1 APN 8 89032568 missense probably damaging 0.99
IGL02354:Sall1 APN 8 89033049 missense probably benign 0.10
IGL02727:Sall1 APN 8 89030755 missense probably damaging 1.00
IGL02943:Sall1 APN 8 89031121 missense probably damaging 0.99
IGL03179:Sall1 APN 8 89031661 missense probably benign 0.00
PIT4651001:Sall1 UTSW 8 89031103 missense probably damaging 1.00
R0089:Sall1 UTSW 8 89030268 missense probably benign 0.09
R0386:Sall1 UTSW 8 89032604 missense probably damaging 1.00
R0532:Sall1 UTSW 8 89033191 missense probably benign
R0555:Sall1 UTSW 8 89031758 missense probably benign 0.16
R1203:Sall1 UTSW 8 89031934 missense probably damaging 1.00
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1449:Sall1 UTSW 8 89032483 missense probably benign
R1477:Sall1 UTSW 8 89032882 missense probably damaging 1.00
R1692:Sall1 UTSW 8 89028400 missense probably benign 0.00
R1839:Sall1 UTSW 8 89028716 missense possibly damaging 0.89
R2016:Sall1 UTSW 8 89028409 missense probably benign 0.10
R2041:Sall1 UTSW 8 89032801 missense probably benign
R3808:Sall1 UTSW 8 89031473 nonsense probably null
R3816:Sall1 UTSW 8 89032675 missense probably benign 0.00
R4085:Sall1 UTSW 8 89028509 missense probably benign
R4604:Sall1 UTSW 8 89030341 missense probably damaging 1.00
R5760:Sall1 UTSW 8 89028650 missense possibly damaging 0.94
R6091:Sall1 UTSW 8 89028619 missense probably damaging 1.00
R6213:Sall1 UTSW 8 89033058 small deletion probably benign
R6326:Sall1 UTSW 8 89030268 missense probably benign 0.09
R6920:Sall1 UTSW 8 89030393 missense probably damaging 1.00
R6954:Sall1 UTSW 8 89032891 missense probably damaging 1.00
R7395:Sall1 UTSW 8 89030921 missense possibly damaging 0.86
R7396:Sall1 UTSW 8 89032768 missense probably damaging 1.00
R7493:Sall1 UTSW 8 89031053 missense probably benign 0.32
R7555:Sall1 UTSW 8 89033158 missense possibly damaging 0.90
R7672:Sall1 UTSW 8 89031299 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGGCTATCTTGGGAAGC -3'
(R):5'- TCAGAGCGCCTTGAAAATGC -3'

Sequencing Primer
(F):5'- TATCTTGGGAAGCGTCCGC -3'
(R):5'- GCCTTGAAAATGCACTACCGG -3'
Posted On2015-10-21