Incidental Mutation 'R4701:Ascc3'
ID356054
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 041949-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50720664 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1230 (N1230S)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035606
AA Change: N1230S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: N1230S

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 splice site probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50845700 missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R8021:Ascc3 UTSW 10 50731648 missense probably benign 0.02
R8134:Ascc3 UTSW 10 50767458 missense probably benign 0.02
R8252:Ascc3 UTSW 10 50642610 missense probably benign
R8348:Ascc3 UTSW 10 50618077 missense probably benign
R8362:Ascc3 UTSW 10 50642596 missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50649304 missense possibly damaging 0.93
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50718421 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGTTATAGTTGTGCAGCATTG -3'
(R):5'- TCTTCCTTTAACACTACAGAGGCAG -3'

Sequencing Primer
(F):5'- CAGCATTGTAGATACATTCAGTTGCC -3'
(R):5'- GCAAAATAACGGAATAGCCTC -3'
Posted On2015-10-21