Incidental Mutation 'R4701:Flt4'
ID356058
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 041949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49626808 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 319 (F319S)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020617
AA Change: F319S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: F319S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Meta Mutation Damage Score 0.5147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGAACCACTTGTGCTTGGG -3'
(R):5'- TCTGCAGACTGGAGCTTTGC -3'

Sequencing Primer
(F):5'- GGGTTAGCTCTGTCTCTGCC -3'
(R):5'- AGACTGGAGCTTTGCCTCGC -3'
Posted On2015-10-21