Incidental Mutation 'R4701:Flt4'
ID 356058
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene Name FMS-like tyrosine kinase 4
Synonyms VEGFR3, VEGFR-3, Flt-4
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 49500506-49543566 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49517635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 319 (F319S)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
AlphaFold P35917
Predicted Effect possibly damaging
Transcript: ENSMUST00000020617
AA Change: F319S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: F319S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Meta Mutation Damage Score 0.5147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plce1 A T 19: 38,713,451 (GRCm39) T1240S probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49,526,088 (GRCm39) missense probably damaging 1.00
IGL01140:Flt4 APN 11 49,525,770 (GRCm39) nonsense probably null
IGL01360:Flt4 APN 11 49,534,333 (GRCm39) missense probably benign 0.04
IGL01386:Flt4 APN 11 49,528,162 (GRCm39) missense probably benign 0.00
IGL01769:Flt4 APN 11 49,525,998 (GRCm39) splice site probably benign
IGL02189:Flt4 APN 11 49,516,830 (GRCm39) missense probably damaging 1.00
IGL02206:Flt4 APN 11 49,521,217 (GRCm39) missense probably damaging 0.98
IGL02324:Flt4 APN 11 49,536,822 (GRCm39) missense probably benign 0.13
IGL02433:Flt4 APN 11 49,521,400 (GRCm39) missense probably benign 0.01
IGL03009:Flt4 APN 11 49,517,951 (GRCm39) missense probably benign 0.02
IGL03035:Flt4 APN 11 49,536,724 (GRCm39) nonsense probably null
IGL03059:Flt4 APN 11 49,533,134 (GRCm39) missense probably damaging 0.97
IGL03350:Flt4 APN 11 49,525,620 (GRCm39) nonsense probably null
PIT4802001:Flt4 UTSW 11 49,523,996 (GRCm39) missense probably benign
R0360:Flt4 UTSW 11 49,527,818 (GRCm39) missense probably benign 0.02
R0364:Flt4 UTSW 11 49,527,818 (GRCm39) missense probably benign 0.02
R0386:Flt4 UTSW 11 49,535,213 (GRCm39) missense probably benign 0.00
R0395:Flt4 UTSW 11 49,521,170 (GRCm39) missense probably benign 0.00
R0600:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R0666:Flt4 UTSW 11 49,516,274 (GRCm39) missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R0734:Flt4 UTSW 11 49,517,544 (GRCm39) missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1013:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1103:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1104:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1162:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1241:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1401:Flt4 UTSW 11 49,527,166 (GRCm39) splice site probably benign
R1487:Flt4 UTSW 11 49,523,971 (GRCm39) missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49,522,808 (GRCm39) missense probably benign 0.03
R1999:Flt4 UTSW 11 49,536,824 (GRCm39) missense probably benign 0.00
R2110:Flt4 UTSW 11 49,516,131 (GRCm39) missense probably benign 0.03
R2150:Flt4 UTSW 11 49,536,824 (GRCm39) missense probably benign 0.00
R2189:Flt4 UTSW 11 49,526,525 (GRCm39) missense probably benign 0.24
R2217:Flt4 UTSW 11 49,515,555 (GRCm39) missense probably benign 0.00
R2218:Flt4 UTSW 11 49,515,555 (GRCm39) missense probably benign 0.00
R2249:Flt4 UTSW 11 49,536,786 (GRCm39) missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49,528,646 (GRCm39) missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49,524,941 (GRCm39) missense probably damaging 0.99
R3974:Flt4 UTSW 11 49,527,567 (GRCm39) missense probably damaging 0.99
R4168:Flt4 UTSW 11 49,521,400 (GRCm39) missense probably benign 0.01
R4700:Flt4 UTSW 11 49,517,271 (GRCm39) intron probably benign
R4714:Flt4 UTSW 11 49,518,034 (GRCm39) missense probably damaging 0.99
R4817:Flt4 UTSW 11 49,516,242 (GRCm39) missense probably damaging 0.98
R4921:Flt4 UTSW 11 49,517,970 (GRCm39) missense probably damaging 0.98
R5066:Flt4 UTSW 11 49,524,990 (GRCm39) missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49,517,986 (GRCm39) missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49,524,084 (GRCm39) splice site probably null
R5245:Flt4 UTSW 11 49,541,861 (GRCm39) frame shift probably null
R5250:Flt4 UTSW 11 49,521,227 (GRCm39) missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49,541,861 (GRCm39) frame shift probably null
R5401:Flt4 UTSW 11 49,541,861 (GRCm39) frame shift probably null
R5402:Flt4 UTSW 11 49,541,861 (GRCm39) frame shift probably null
R5527:Flt4 UTSW 11 49,525,581 (GRCm39) missense probably damaging 1.00
R5686:Flt4 UTSW 11 49,521,430 (GRCm39) missense probably benign 0.00
R5766:Flt4 UTSW 11 49,517,513 (GRCm39) missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49,541,897 (GRCm39) missense probably damaging 1.00
R6037:Flt4 UTSW 11 49,527,867 (GRCm39) missense probably damaging 1.00
R6037:Flt4 UTSW 11 49,527,867 (GRCm39) missense probably damaging 1.00
R6352:Flt4 UTSW 11 49,534,333 (GRCm39) missense probably benign 0.04
R6361:Flt4 UTSW 11 49,521,405 (GRCm39) missense probably benign 0.00
R6574:Flt4 UTSW 11 49,516,199 (GRCm39) missense probably benign
R7205:Flt4 UTSW 11 49,525,125 (GRCm39) missense probably null 0.78
R7216:Flt4 UTSW 11 49,525,508 (GRCm39) missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49,516,836 (GRCm39) missense probably benign 0.22
R7457:Flt4 UTSW 11 49,521,155 (GRCm39) missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49,535,198 (GRCm39) missense possibly damaging 0.50
R8181:Flt4 UTSW 11 49,525,723 (GRCm39) missense probably damaging 0.99
R8286:Flt4 UTSW 11 49,528,089 (GRCm39) missense probably benign 0.00
R8885:Flt4 UTSW 11 49,527,160 (GRCm39) splice site probably benign
R9051:Flt4 UTSW 11 49,527,598 (GRCm39) missense probably benign 0.02
R9104:Flt4 UTSW 11 49,525,161 (GRCm39) missense probably damaging 1.00
R9112:Flt4 UTSW 11 49,524,064 (GRCm39) missense probably damaging 1.00
R9301:Flt4 UTSW 11 49,516,241 (GRCm39) missense possibly damaging 0.92
R9721:Flt4 UTSW 11 49,535,260 (GRCm39) critical splice donor site probably null
X0017:Flt4 UTSW 11 49,517,560 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGAACCACTTGTGCTTGGG -3'
(R):5'- TCTGCAGACTGGAGCTTTGC -3'

Sequencing Primer
(F):5'- GGGTTAGCTCTGTCTCTGCC -3'
(R):5'- AGACTGGAGCTTTGCCTCGC -3'
Posted On 2015-10-21