Mutagenetix > Incidental Mutations

Incidental Mutation 'R4701:Lamb1'

356063

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

041949-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 31266848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 65 (C65*)

Ref Sequence

ENSEMBL: ENSMUSP00000132778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088] [ENSMUST00000170495]

AlphaFold

P02469

PDB Structure

Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000002979
AA Change: C113*

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: C113*

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164228

Predicted Effect

probably null
Transcript: ENSMUST00000164919
AA Change: C113*

SMART Domains

Protein: ENSMUSP00000132616
Gene: ENSMUSG00000002900
AA Change: C113*

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169088
AA Change: C65*

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: C65*

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170495

SMART Domains

Protein: ENSMUSP00000132001
Gene: ENSMUSG00000002900

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1854:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4767:Lamb1	UTSW	12	31308011	missense	probably damaging	1.00
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4842:Lamb1	UTSW	12	31287433	missense	probably damaging	1.00
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5825:Lamb1	UTSW	12	31318614	missense	probably benign
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6313:Lamb1	UTSW	12	31269147	missense	probably damaging	1.00
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- AGGCCTTTTCTGCGCCTATC -3'
(R):5'- TGGTGTTAGGTGGCAGGAAA -3'

Sequencing Primer
(F):5'- CCCTGGCTTGTCGGTTGC -3'
(R):5'- TGCGACTGTGCAAATGGAGATTG -3'

Posted On

2015-10-21