Incidental Mutation 'R4701:Plce1'
ID 356084
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms PLCepsilon, 4933403A21Rik
MMRRC Submission 041949-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R4701 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 38469557-38773474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38713451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1240 (T1240S)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect probably benign
Transcript: ENSMUST00000169713
AA Change: T1240S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: T1240S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182267
AA Change: T1240S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: T1240S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182481
AA Change: T1240S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: T1240S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182589
Meta Mutation Damage Score 0.0651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,301,986 (GRCm39) I196V probably benign Het
Aass T A 6: 23,075,855 (GRCm39) K761* probably null Het
Abca13 A G 11: 9,242,306 (GRCm39) T1390A possibly damaging Het
Abhd16a T C 17: 35,315,582 (GRCm39) probably null Het
Acad11 C T 9: 103,972,764 (GRCm39) Q486* probably null Het
Actl9 T C 17: 33,652,909 (GRCm39) L323P probably benign Het
Adam12 T A 7: 133,518,191 (GRCm39) I650F possibly damaging Het
Adgre4 A T 17: 56,091,971 (GRCm39) D77V probably damaging Het
Ankrd26 A G 6: 118,483,446 (GRCm39) F1586S possibly damaging Het
Anpep T C 7: 79,489,213 (GRCm39) T320A probably benign Het
Arl15 T A 13: 114,104,261 (GRCm39) C133S probably benign Het
Ascc3 A G 10: 50,596,760 (GRCm39) N1230S possibly damaging Het
Atf4 T A 15: 80,141,618 (GRCm39) I336K probably damaging Het
Atp7b A T 8: 22,490,137 (GRCm39) S1044T probably benign Het
Atp8b4 A G 2: 126,256,213 (GRCm39) F249L probably damaging Het
AU021092 G T 16: 5,030,057 (GRCm39) N319K probably benign Het
Bbs4 A G 9: 59,230,802 (GRCm39) V440A probably benign Het
Bpifb4 G T 2: 153,792,305 (GRCm39) G450C probably damaging Het
Cadm1 G A 9: 47,730,120 (GRCm39) probably benign Het
Ccser2 G A 14: 36,660,654 (GRCm39) L500F probably damaging Het
Cd22 T A 7: 30,575,578 (GRCm39) I155F probably damaging Het
Cdkl4 A T 17: 80,851,081 (GRCm39) V207E probably damaging Het
Cfap251 A G 5: 123,460,676 (GRCm39) K1213E probably benign Het
Cfap65 T C 1: 74,958,067 (GRCm39) D947G probably damaging Het
Cntn6 T C 6: 104,781,321 (GRCm39) V397A probably benign Het
Cpox T A 16: 58,498,332 (GRCm39) Y388* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dda1 T A 8: 71,926,454 (GRCm39) Y58N probably damaging Het
Dennd4a C T 9: 64,804,639 (GRCm39) T1326I possibly damaging Het
Eps8l2 A T 7: 140,937,173 (GRCm39) I338F probably damaging Het
Fbxo42 A G 4: 140,927,120 (GRCm39) T467A probably benign Het
Flt4 T C 11: 49,517,635 (GRCm39) F319S possibly damaging Het
Fmn1 A T 2: 113,414,416 (GRCm39) Y895F possibly damaging Het
Gm6887 C A 7: 42,114,517 (GRCm39) noncoding transcript Het
Grid2 A G 6: 64,642,899 (GRCm39) D887G probably benign Het
Grm6 C T 11: 50,753,837 (GRCm39) P714S probably damaging Het
Gsto2 A G 19: 47,873,095 (GRCm39) I157V probably benign Het
Il15ra A G 2: 11,723,156 (GRCm39) probably null Het
Impg1 A G 9: 80,221,682 (GRCm39) F713L probably benign Het
Jag1 T A 2: 136,936,376 (GRCm39) T373S probably benign Het
Kcnh3 T A 15: 99,139,826 (GRCm39) L904Q probably benign Het
Kctd19 C A 8: 106,117,061 (GRCm39) G356V possibly damaging Het
Kdm5b T A 1: 134,533,750 (GRCm39) probably benign Het
Kif1a T C 1: 93,006,557 (GRCm39) I37V probably damaging Het
Lama5 G A 2: 179,833,489 (GRCm39) R1508C probably damaging Het
Lamb1 T A 12: 31,316,847 (GRCm39) C65* probably null Het
Lingo1 A G 9: 56,527,542 (GRCm39) F349S probably damaging Het
Loxl4 G A 19: 42,596,052 (GRCm39) H147Y probably benign Het
Lrrn4cl T A 19: 8,829,419 (GRCm39) N132K probably damaging Het
Med17 A T 9: 15,181,656 (GRCm39) H31Q probably damaging Het
Med23 A T 10: 24,769,546 (GRCm39) L476F probably damaging Het
Mgst1 A T 6: 138,127,836 (GRCm39) D66V probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Muc4 A T 16: 32,576,220 (GRCm39) probably benign Het
Myo18a C T 11: 77,708,491 (GRCm39) T30M probably damaging Het
Ncapg2 G T 12: 116,404,238 (GRCm39) R903L probably benign Het
Nme1 A G 11: 93,856,734 (GRCm39) I9T probably damaging Het
Nmt2 T A 2: 3,323,678 (GRCm39) I357N probably benign Het
Nphp4 T C 4: 152,581,116 (GRCm39) F100S probably damaging Het
Oca2 C A 7: 55,904,750 (GRCm39) T72K probably benign Het
Or52e4 A T 7: 104,706,086 (GRCm39) D211V probably damaging Het
Or52e7 A T 7: 104,684,798 (GRCm39) D131V probably damaging Het
Or52z15 G A 7: 103,332,269 (GRCm39) V105M probably damaging Het
Or7h8 T C 9: 20,123,921 (GRCm39) I92T probably damaging Het
Or9s15 C A 1: 92,525,160 (GRCm39) D306E probably benign Het
Plch1 A T 3: 63,606,917 (GRCm39) probably null Het
Plxna4 T C 6: 32,493,623 (GRCm39) D331G probably damaging Het
Ppp1r3a T C 6: 14,718,992 (GRCm39) T641A probably benign Het
Rab32 A G 10: 10,426,598 (GRCm39) L116P probably benign Het
Recql4 C T 15: 76,592,785 (GRCm39) C302Y probably damaging Het
Rorc G C 3: 94,299,017 (GRCm39) E391Q probably null Het
Saa4 A T 7: 46,381,051 (GRCm39) F24I possibly damaging Het
Sall1 T A 8: 89,757,788 (GRCm39) K772M probably damaging Het
Sdk1 T G 5: 142,170,986 (GRCm39) L1950V probably damaging Het
Sil1 T C 18: 35,399,949 (GRCm39) E352G probably benign Het
Slc26a3 C T 12: 31,497,773 (GRCm39) P59L probably damaging Het
Smco2 T C 6: 146,763,440 (GRCm39) probably benign Het
Sppl3 A G 5: 115,241,372 (GRCm39) probably null Het
St6gal2 T A 17: 55,803,345 (GRCm39) V360D probably damaging Het
Stard9 G A 2: 120,536,194 (GRCm39) R345Q possibly damaging Het
Susd4 T A 1: 182,719,626 (GRCm39) Y414N probably damaging Het
Tenm4 T C 7: 96,544,556 (GRCm39) Y2191H probably damaging Het
Tln2 A G 9: 67,253,809 (GRCm39) V754A probably benign Het
Tmem132c T A 5: 127,641,560 (GRCm39) probably benign Het
Tnn A T 1: 159,975,338 (GRCm39) S30T possibly damaging Het
Trpd52l3 G T 19: 29,981,895 (GRCm39) V217F probably damaging Het
Trpm1 G T 7: 63,893,248 (GRCm39) L1033F probably damaging Het
Tulp2 A G 7: 45,167,348 (GRCm39) E182G probably damaging Het
Ubr4 A G 4: 139,198,647 (GRCm39) K4490R possibly damaging Het
Usp17la A T 7: 104,509,856 (GRCm39) R154* probably null Het
Vmn2r17 T G 5: 109,575,849 (GRCm39) M240R probably damaging Het
Vmn2r22 T A 6: 123,627,428 (GRCm39) N56I probably benign Het
Zdhhc21 A T 4: 82,738,571 (GRCm39) I206N possibly damaging Het
Zfp148 T A 16: 33,277,278 (GRCm39) D122E probably benign Het
Zfp804a A T 2: 82,086,926 (GRCm39) S252C probably damaging Het
Zgrf1 C T 3: 127,392,353 (GRCm39) T1291I probably benign Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38,734,232 (GRCm39) missense probably damaging 0.99
IGL00336:Plce1 APN 19 38,640,350 (GRCm39) missense probably damaging 1.00
IGL00430:Plce1 APN 19 38,713,461 (GRCm39) missense probably damaging 1.00
IGL00466:Plce1 APN 19 38,709,473 (GRCm39) missense probably damaging 0.99
IGL00477:Plce1 APN 19 38,513,576 (GRCm39) missense probably benign 0.39
IGL00839:Plce1 APN 19 38,687,006 (GRCm39) missense probably damaging 1.00
IGL01292:Plce1 APN 19 38,640,229 (GRCm39) splice site probably benign
IGL01665:Plce1 APN 19 38,513,331 (GRCm39) missense probably benign 0.01
IGL01826:Plce1 APN 19 38,727,682 (GRCm39) splice site probably benign
IGL01833:Plce1 APN 19 38,709,425 (GRCm39) missense probably damaging 1.00
IGL02201:Plce1 APN 19 38,757,890 (GRCm39) splice site probably benign
IGL02276:Plce1 APN 19 38,513,201 (GRCm39) missense probably benign 0.05
IGL02477:Plce1 APN 19 38,707,997 (GRCm39) splice site probably benign
IGL02746:Plce1 APN 19 38,686,916 (GRCm39) missense probably damaging 1.00
Angel_food UTSW 19 38,715,457 (GRCm39) splice site probably benign
Heavenly UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38,769,228 (GRCm39) critical splice donor site probably null
R0116:Plce1 UTSW 19 38,710,265 (GRCm39) missense probably benign
R0138:Plce1 UTSW 19 38,512,863 (GRCm39) missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0504:Plce1 UTSW 19 38,766,465 (GRCm39) splice site probably benign
R0506:Plce1 UTSW 19 38,748,582 (GRCm39) missense probably benign 0.04
R0578:Plce1 UTSW 19 38,766,383 (GRCm39) missense probably damaging 1.00
R0645:Plce1 UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0730:Plce1 UTSW 19 38,705,135 (GRCm39) missense probably damaging 0.98
R0920:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,755,670 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,690,457 (GRCm39) missense probably damaging 1.00
R1484:Plce1 UTSW 19 38,693,783 (GRCm39) nonsense probably null
R1488:Plce1 UTSW 19 38,705,247 (GRCm39) missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38,709,440 (GRCm39) missense probably damaging 1.00
R1624:Plce1 UTSW 19 38,713,219 (GRCm39) missense probably damaging 1.00
R1732:Plce1 UTSW 19 38,705,282 (GRCm39) missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38,769,234 (GRCm39) splice site probably benign
R1797:Plce1 UTSW 19 38,747,392 (GRCm39) critical splice donor site probably null
R1872:Plce1 UTSW 19 38,748,521 (GRCm39) missense probably damaging 1.00
R1876:Plce1 UTSW 19 38,769,067 (GRCm39) missense probably damaging 1.00
R1991:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2080:Plce1 UTSW 19 38,715,457 (GRCm39) splice site probably benign
R2103:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2376:Plce1 UTSW 19 38,766,430 (GRCm39) missense probably benign 0.02
R2471:Plce1 UTSW 19 38,768,370 (GRCm39) missense probably damaging 1.00
R2511:Plce1 UTSW 19 38,748,498 (GRCm39) missense probably damaging 1.00
R2842:Plce1 UTSW 19 38,512,727 (GRCm39) missense probably damaging 1.00
R3037:Plce1 UTSW 19 38,766,328 (GRCm39) missense probably damaging 0.98
R3104:Plce1 UTSW 19 38,608,963 (GRCm39) missense probably benign 0.00
R3700:Plce1 UTSW 19 38,693,781 (GRCm39) missense probably damaging 1.00
R3750:Plce1 UTSW 19 38,766,343 (GRCm39) missense probably benign
R3753:Plce1 UTSW 19 38,640,278 (GRCm39) missense probably benign 0.09
R4027:Plce1 UTSW 19 38,512,709 (GRCm39) missense probably damaging 1.00
R4057:Plce1 UTSW 19 38,748,563 (GRCm39) missense probably damaging 1.00
R4376:Plce1 UTSW 19 38,693,891 (GRCm39) critical splice donor site probably null
R4433:Plce1 UTSW 19 38,755,745 (GRCm39) missense probably damaging 1.00
R4520:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38,513,088 (GRCm39) missense probably benign 0.30
R4673:Plce1 UTSW 19 38,737,840 (GRCm39) missense possibly damaging 0.51
R4828:Plce1 UTSW 19 38,757,943 (GRCm39) missense probably damaging 1.00
R5103:Plce1 UTSW 19 38,755,659 (GRCm39) missense probably damaging 1.00
R5112:Plce1 UTSW 19 38,640,277 (GRCm39) missense probably benign 0.00
R5236:Plce1 UTSW 19 38,758,791 (GRCm39) missense probably benign 0.11
R5268:Plce1 UTSW 19 38,747,279 (GRCm39) missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5384:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5386:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5448:Plce1 UTSW 19 38,768,361 (GRCm39) missense probably damaging 1.00
R5452:Plce1 UTSW 19 38,608,926 (GRCm39) missense probably benign 0.01
R6004:Plce1 UTSW 19 38,710,315 (GRCm39) missense probably damaging 1.00
R6062:Plce1 UTSW 19 38,513,195 (GRCm39) missense probably benign
R6147:Plce1 UTSW 19 38,690,481 (GRCm39) missense probably damaging 1.00
R6247:Plce1 UTSW 19 38,734,289 (GRCm39) missense probably damaging 1.00
R6278:Plce1 UTSW 19 38,713,495 (GRCm39) splice site probably null
R6306:Plce1 UTSW 19 38,757,909 (GRCm39) missense probably damaging 1.00
R6317:Plce1 UTSW 19 38,512,974 (GRCm39) nonsense probably null
R6437:Plce1 UTSW 19 38,513,576 (GRCm39) missense probably benign 0.39
R6522:Plce1 UTSW 19 38,736,965 (GRCm39) splice site probably null
R7034:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7036:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7037:Plce1 UTSW 19 38,690,461 (GRCm39) missense probably damaging 1.00
R7069:Plce1 UTSW 19 38,747,384 (GRCm39) missense probably damaging 1.00
R7180:Plce1 UTSW 19 38,768,229 (GRCm39) missense probably damaging 1.00
R7189:Plce1 UTSW 19 38,748,581 (GRCm39) missense probably damaging 0.97
R7227:Plce1 UTSW 19 38,715,346 (GRCm39) missense probably benign 0.00
R7253:Plce1 UTSW 19 38,686,952 (GRCm39) missense probably damaging 1.00
R7278:Plce1 UTSW 19 38,768,340 (GRCm39) missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38,690,347 (GRCm39) missense probably benign 0.02
R7422:Plce1 UTSW 19 38,640,329 (GRCm39) missense probably damaging 1.00
R7557:Plce1 UTSW 19 38,753,848 (GRCm39) missense probably benign 0.30
R7607:Plce1 UTSW 19 38,513,196 (GRCm39) missense probably benign
R7615:Plce1 UTSW 19 38,513,109 (GRCm39) missense probably benign 0.18
R7653:Plce1 UTSW 19 38,737,763 (GRCm39) missense probably benign 0.20
R7685:Plce1 UTSW 19 38,736,877 (GRCm39) missense probably benign 0.00
R7716:Plce1 UTSW 19 38,705,295 (GRCm39) missense probably benign
R7744:Plce1 UTSW 19 38,608,899 (GRCm39) missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38,769,140 (GRCm39) missense probably damaging 0.97
R7921:Plce1 UTSW 19 38,608,997 (GRCm39) missense probably benign 0.03
R8070:Plce1 UTSW 19 38,690,283 (GRCm39) missense probably damaging 0.99
R8087:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R8116:Plce1 UTSW 19 38,513,262 (GRCm39) missense probably benign 0.32
R8178:Plce1 UTSW 19 38,761,423 (GRCm39) missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38,640,380 (GRCm39) missense probably benign 0.00
R8416:Plce1 UTSW 19 38,761,441 (GRCm39) missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38,512,903 (GRCm39) missense probably benign 0.00
R8713:Plce1 UTSW 19 38,513,345 (GRCm39) missense probably benign 0.01
R8850:Plce1 UTSW 19 38,512,811 (GRCm39) missense probably benign
R9217:Plce1 UTSW 19 38,748,551 (GRCm39) missense probably damaging 1.00
R9231:Plce1 UTSW 19 38,705,040 (GRCm39) missense probably benign 0.13
R9232:Plce1 UTSW 19 38,705,423 (GRCm39) missense probably benign 0.16
R9332:Plce1 UTSW 19 38,726,377 (GRCm39) missense probably damaging 1.00
R9473:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9475:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9751:Plce1 UTSW 19 38,717,414 (GRCm39) missense probably damaging 1.00
R9780:Plce1 UTSW 19 38,609,134 (GRCm39) missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38,513,654 (GRCm39) missense probably damaging 1.00
RF018:Plce1 UTSW 19 38,705,651 (GRCm39) missense probably damaging 0.99
X0022:Plce1 UTSW 19 38,715,443 (GRCm39) missense probably damaging 1.00
X0065:Plce1 UTSW 19 38,766,358 (GRCm39) missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38,757,904 (GRCm39) missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38,713,424 (GRCm39) nonsense probably null
Z1176:Plce1 UTSW 19 38,690,338 (GRCm39) missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38,640,286 (GRCm39) missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- CTCAGACAGTAACATGAGTTTCG -3'
(R):5'- CAGTTTCACCAAGCTCCAGG -3'

Sequencing Primer
(F):5'- CGTCGAGCTGTTCAAATCATTCAGG -3'
(R):5'- TTTCACCAAGCTCCAGGTAGCAG -3'
Posted On 2015-10-21