Incidental Mutation 'R4702:Rtel1'
ID356098
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 041950-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 181352169 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 849 (S849T)
Ref Sequence ENSEMBL: ENSMUSP00000104443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
Predicted Effect probably benign
Transcript: ENSMUST00000048608
AA Change: S849T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: S849T

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: S849T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: S849T

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: S849T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: S849T

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: S849T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: S849T

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: S849T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: S849T

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect probably benign
Transcript: ENSMUST00000133856
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: S665T

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: S665T

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,329,403 T1316A probably benign Het
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 probably benign Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bloc1s1 T A 10: 128,923,398 Q13L probably damaging Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably benign Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N229S probably benign Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Lama3 T A 18: 12,578,029 L1567* probably null Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Myo15b A G 11: 115,884,008 T2119A probably benign Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q687H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Scn10a A T 9: 119,633,791 Y1060N possibly damaging Het
Selenov A G 7: 28,288,011 L314P probably damaging Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tnip1 A G 11: 54,924,402 S339P probably benign Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCCATAGGTGTGTGG -3'
(R):5'- TGAGTAGACTGCCAGACTGAC -3'

Sequencing Primer
(F):5'- CAGAAGCAGTATCCTTGCTTACTG -3'
(R):5'- TGACCCACCAAAGAGACATGGTG -3'
Posted On2015-10-21