Incidental Mutation 'R4702:Tnip1'
ID356150
Institutional Source Beutler Lab
Gene Symbol Tnip1
Ensembl Gene ENSMUSG00000020400
Gene NameTNFAIP3 interacting protein 1
SynonymsABIN1, VAN, A20-binding inhibitor of NF-kappa B activation, Nef
MMRRC Submission 041950-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54910785-54962917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54924402 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 339 (S339P)
Ref Sequence ENSEMBL: ENSMUSP00000099791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000126703]
Predicted Effect probably benign
Transcript: ENSMUST00000018482
AA Change: S339P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400
AA Change: S339P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102730
AA Change: S339P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400
AA Change: S339P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
AA Change: S339P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400
AA Change: S339P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
AA Change: S286P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400
AA Change: S286P

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
AA Change: S286P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400
AA Change: S286P

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
AA Change: S339P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400
AA Change: S339P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect probably benign
Transcript: ENSMUST00000126703
SMART Domains Protein: ENSMUSP00000122836
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132224
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,329,403 T1316A probably benign Het
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 probably benign Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bloc1s1 T A 10: 128,923,398 Q13L probably damaging Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably benign Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N229S probably benign Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Lama3 T A 18: 12,578,029 L1567* probably null Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Myo15b A G 11: 115,884,008 T2119A probably benign Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q687H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Rtel1 T A 2: 181,352,169 S849T probably benign Het
Scn10a A T 9: 119,633,791 Y1060N possibly damaging Het
Selenov A G 7: 28,288,011 L314P probably damaging Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in Tnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnip1 APN 11 54940817 nonsense probably null
IGL02045:Tnip1 APN 11 54911539 makesense probably null
IGL02227:Tnip1 APN 11 54936471 missense possibly damaging 0.90
IGL03093:Tnip1 APN 11 54940826 nonsense probably null
trinity UTSW 11 54939596 critical splice donor site probably null
R0480:Tnip1 UTSW 11 54937994 missense probably damaging 0.96
R0511:Tnip1 UTSW 11 54917873 missense probably damaging 1.00
R2974:Tnip1 UTSW 11 54933983 unclassified probably benign
R4059:Tnip1 UTSW 11 54911569 missense probably benign 0.01
R4475:Tnip1 UTSW 11 54939596 critical splice donor site probably null
R4509:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4510:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4511:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4784:Tnip1 UTSW 11 54915539 missense possibly damaging 0.66
R5008:Tnip1 UTSW 11 54937984 missense probably benign 0.01
R5461:Tnip1 UTSW 11 54910799 unclassified probably benign
R6050:Tnip1 UTSW 11 54917877 missense probably damaging 1.00
R6992:Tnip1 UTSW 11 54918716 missense probably benign 0.01
R7198:Tnip1 UTSW 11 54917804 missense probably benign 0.00
R7730:Tnip1 UTSW 11 54937979 missense probably benign 0.00
R8503:Tnip1 UTSW 11 54936465 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTCACGCTGCTTCTGCTC -3'
(R):5'- CAGCCCAGATTGCAGCTTTATC -3'

Sequencing Primer
(F):5'- GTTTCTGCAGGTCCACCAG -3'
(R):5'- ATCAGCATGTACTTTGGGCGC -3'
Posted On2015-10-21