Mutagenetix > Incidental Mutation

Incidental Mutation 'R4703:Ifih1'

356185

Institutional Source

Beutler Lab

Gene Symbol

Ifih1

Ensembl Gene

ENSMUSG00000026896

Gene Name

interferon induced with helicase C domain 1

Synonyms

MDA5, Helicard, 9130009C22Rik, MDA-5

MMRRC Submission

041951-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62595798-62646255 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62598876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 906 (L906H)

Ref Sequence

ENSEMBL: ENSMUSP00000028259 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]

AlphaFold

Q8R5F7

PDB Structure

Crystal Structure of the MDA5 Helicase Insert Domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028259
AA Change: L906H

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: L906H

Domain	Start	End	E-Value	Type
Pfam:CARD_2	7	99	3e-22	PFAM
Pfam:CARD_2	110	200	6.8e-22	PFAM
Pfam:CARD	115	200	2.6e-15	PFAM
low complexity region	248	261	N/A	INTRINSIC
DEXDc	305	520	1.08e-26	SMART
Blast:DEXDc	590	712	1e-45	BLAST
HELICc	742	826	1.27e-14	SMART
Pfam:RIG-I_C-RD	903	1018	4.2e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112459
AA Change: L857H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: L857H

Domain	Start	End	E-Value	Type
SCOP:d3ygsp_	6	88	1e-3	SMART
Pfam:CARD	115	200	3.9e-15	PFAM
DEXDc	256	471	1.08e-26	SMART
Blast:DEXDc	541	663	1e-45	BLAST
HELICc	693	777	1.27e-14	SMART
Pfam:RIG-I_C-RD	852	973	1.5e-43	PFAM

Meta Mutation Damage Score

0.1111

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Dntt	T	A	19: 41,039,803	D179E	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Evpl	C	G	11: 116,222,505	R1453P	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Nsd1	T	A	13: 55,214,063	D281E	probably damaging	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in Ifih1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00792:Ifih1	APN	2	62645870	missense	probably damaging	1.00
IGL00832:Ifih1	APN	2	62645470	splice site	probably benign
IGL00906:Ifih1	APN	2	62645824	missense	probably benign
IGL01664:Ifih1	APN	2	62611700	splice site	probably benign
IGL01820:Ifih1	APN	2	62617313	missense	probably damaging	1.00
IGL02016:Ifih1	APN	2	62606984	missense	probably benign	0.01
IGL02298:Ifih1	APN	2	62610439	critical splice donor site	probably null
IGL02311:Ifih1	APN	2	62610503	missense	probably damaging	1.00
IGL02635:Ifih1	APN	2	62611829	missense	probably damaging	1.00
Washington	UTSW	2	62598799	missense	possibly damaging	0.88
R0514:Ifih1	UTSW	2	62623391	critical splice donor site	probably null
R1329:Ifih1	UTSW	2	62617487	splice site	probably null
R1484:Ifih1	UTSW	2	62610558	missense	probably benign	0.00
R1769:Ifih1	UTSW	2	62606394	missense	probably damaging	1.00
R2104:Ifih1	UTSW	2	62610545	nonsense	probably null
R2125:Ifih1	UTSW	2	62623467	missense	probably benign	0.43
R2126:Ifih1	UTSW	2	62623467	missense	probably benign	0.43
R2406:Ifih1	UTSW	2	62607103	splice site	probably benign
R3919:Ifih1	UTSW	2	62623501	splice site	probably benign
R4033:Ifih1	UTSW	2	62635190	missense	probably benign
R4060:Ifih1	UTSW	2	62598799	missense	possibly damaging	0.88
R4435:Ifih1	UTSW	2	62645890	missense	probably damaging	1.00
R4538:Ifih1	UTSW	2	62617412	missense	probably damaging	1.00
R4663:Ifih1	UTSW	2	62609219	missense	probably benign	0.00
R4897:Ifih1	UTSW	2	62635014	intron	probably benign
R5274:Ifih1	UTSW	2	62611718	missense	probably benign	0.00
R5949:Ifih1	UTSW	2	62610560	missense	probably benign	0.05
R6140:Ifih1	UTSW	2	62601460	missense	possibly damaging	0.77
R6223:Ifih1	UTSW	2	62598259	missense	probably benign
R6332:Ifih1	UTSW	2	62639483	missense	possibly damaging	0.64
R6650:Ifih1	UTSW	2	62606447	missense	possibly damaging	0.69
R6813:Ifih1	UTSW	2	62645693	missense	possibly damaging	0.90
R6977:Ifih1	UTSW	2	62606186	missense	probably damaging	1.00
R7054:Ifih1	UTSW	2	62610515	missense	probably benign	0.30
R7167:Ifih1	UTSW	2	62598896	missense	probably benign
R7269:Ifih1	UTSW	2	62645633	missense	probably benign	0.00
R7397:Ifih1	UTSW	2	62623488	missense	possibly damaging	0.85
R7885:Ifih1	UTSW	2	62601469	missense	possibly damaging	0.96
R8672:Ifih1	UTSW	2	62605649	missense	possibly damaging	0.82
R8960:Ifih1	UTSW	2	62611891	missense	possibly damaging	0.89
R9258:Ifih1	UTSW	2	62611898	missense	probably damaging	1.00
R9324:Ifih1	UTSW	2	62645606	missense	probably benign
R9432:Ifih1	UTSW	2	62609274	missense	probably damaging	1.00
Z1176:Ifih1	UTSW	2	62617469	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCGACACAAGAAATGAGATTC -3'
(R):5'- CTGTGATATGCAATTTTCAGCTCG -3'

Sequencing Primer
(F):5'- GGGGGAAAAAGATCTTCCTTTCAC -3'
(R):5'- GCTCGTTTACTTCCATAAAACTAGGG -3'

Posted On

2015-10-21