Incidental Mutation 'R0402:Timm50'
ID35619
Institutional Source Beutler Lab
Gene Symbol Timm50
Ensembl Gene ENSMUSG00000003438
Gene Nametranslocase of inner mitochondrial membrane 50
SynonymsTIM50L, 2810403L02Rik
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28305516-28312072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28306855 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 274 (R274W)
Ref Sequence ENSEMBL: ENSMUSP00000080614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081946] [ENSMUST00000108315]
Predicted Effect probably damaging
Transcript: ENSMUST00000081946
AA Change: R274W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438
AA Change: R274W

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
CPDc 146 274 1.33e-41 SMART
low complexity region 313 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108315
SMART Domains Protein: ENSMUSP00000103951
Gene: ENSMUSG00000003436

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 60 118 3e-18 BLAST
low complexity region 140 154 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
EGF 211 247 1.53e1 SMART
EGF 275 308 3.08e-6 SMART
EGF 313 349 8.25e-7 SMART
EGF 354 387 2.83e-5 SMART
EGF 392 425 1.04e-3 SMART
EGF 430 463 7.07e-6 SMART
transmembrane domain 489 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151990
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the TIM23 inner mitochondrial membrane translocase complex. The encoded protein functions as the receptor subunit that recognizes the mitochondrial targeting signal, or presequence, on protein cargo that is destined for the mitochondrial inner membrane and matrix. This protein may also play a role in maintaining the membrane permeability barrier, and knockdown of this gene in human cells results in the release of cytochrome c and apoptosis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Timm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:Timm50 UTSW 7 28306941 missense probably damaging 1.00
R3881:Timm50 UTSW 7 28311007 missense probably benign
R4604:Timm50 UTSW 7 28311018 missense probably benign
R4947:Timm50 UTSW 7 28310044 unclassified probably benign
R5010:Timm50 UTSW 7 28306859 missense probably benign 0.07
R5359:Timm50 UTSW 7 28308167 missense probably damaging 1.00
R6866:Timm50 UTSW 7 28305945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCAGAAGGCTCCAGGATACTC -3'
(R):5'- GTGACCAGCTTCCCAGTTTCTCAG -3'

Sequencing Primer
(F):5'- GGCTCCAGGATACTCATAAATCTC -3'
(R):5'- TTCTCAGAAGCCTGAGGTTAC -3'
Posted On2013-05-09