Incidental Mutation 'R4703:Vmn2r59'
ID356209
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4703 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42012262 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 710 (I710L)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect probably benign
Transcript: ENSMUST00000168489
AA Change: I710L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: I710L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Limk2 C A 11: 3,347,586 E329* probably null Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Ptpn21 T C 12: 98,679,392 T1096A probably benign Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Stxbp2 A G 8: 3,632,521 S37G probably damaging Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tcf4 A G 18: 69,657,910 Y307C probably damaging Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4653:Vmn2r59 UTSW 7 42043804 missense probably benign 0.19
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 42043753 missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 42043747 missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 42045809 missense probably damaging 1.00
R7733:Vmn2r59 UTSW 7 42012019 missense probably benign 0.17
R7770:Vmn2r59 UTSW 7 42058912 missense probably damaging 1.00
R7812:Vmn2r59 UTSW 7 42045772 nonsense probably null
R7867:Vmn2r59 UTSW 7 42012283 missense probably damaging 1.00
R7950:Vmn2r59 UTSW 7 42012283 missense probably damaging 1.00
R7999:Vmn2r59 UTSW 7 42046832 missense probably damaging 1.00
R8267:Vmn2r59 UTSW 7 42012097 missense probably damaging 0.97
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Z1176:Vmn2r59 UTSW 7 42042517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACTTGGCTTCATTGAAGG -3'
(R):5'- CACAATCACCTGCATCTTGC -3'

Sequencing Primer
(F):5'- CTTCATTGAAGGTGTCAGGAAGATTC -3'
(R):5'- GCATCTTGCAGCAGACAGC -3'
Posted On2015-10-21