Incidental Mutation 'R4703:Stxbp2'
ID356213
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Namesyntaxin binding protein 2
SynonymsmuSec1, Munc18b, Munc-18-2, C79054, Sxtp2, Munc-18b
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4703 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3630955-3643644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3632521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 37 (S37G)
Ref Sequence ENSEMBL: ENSMUSP00000147220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
Predicted Effect unknown
Transcript: ENSMUST00000004745
AA Change: S36G
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626
AA Change: S36G

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159888
Predicted Effect probably damaging
Transcript: ENSMUST00000159911
AA Change: S37G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160435
Predicted Effect probably damaging
Transcript: ENSMUST00000160708
AA Change: S37G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626
AA Change: S37G

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect probably benign
Transcript: ENSMUST00000162867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Meta Mutation Damage Score 0.4589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Limk2 C A 11: 3,347,586 E329* probably null Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Ptpn21 T C 12: 98,679,392 T1096A probably benign Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tcf4 A G 18: 69,657,910 Y307C probably damaging Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r59 T A 7: 42,012,262 I710L probably benign Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3636354 critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3634065 missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3635607 unclassified probably benign
IGL02508:Stxbp2 APN 8 3632531 missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3635629 missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3642685 missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3641736 missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3633342 missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3633267 intron probably benign
R0463:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0608:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3642019 missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3642657 missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3634064 missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3642672 missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3634615 synonymous probably null
R2319:Stxbp2 UTSW 8 3633834 missense possibly damaging 0.95
R3614:Stxbp2 UTSW 8 3631196 missense possibly damaging 0.94
R3870:Stxbp2 UTSW 8 3634079 missense probably damaging 1.00
R3876:Stxbp2 UTSW 8 3633369 critical splice donor site probably null
R6533:Stxbp2 UTSW 8 3642683 missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3632561 missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3641998 missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3641180 missense probably benign
R7152:Stxbp2 UTSW 8 3632583 missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3641151 missense
R8237:Stxbp2 UTSW 8 3635695 missense
R8268:Stxbp2 UTSW 8 3632234 missense
Z1177:Stxbp2 UTSW 8 3641123 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCCAGATCTATGCAGTGCC -3'
(R):5'- GGAAGGAATCCTATAAACCTCCTC -3'

Sequencing Primer
(F):5'- GCTATGAGAGTTGCCTCCAGAATTC -3'
(R):5'- CTCCAGGCTATGTAGGGAGAACTTC -3'
Posted On2015-10-21