Mutagenetix > Incidental Mutations

Incidental Mutation 'R4703:B4galnt1'

356228

Institutional Source

Beutler Lab

Gene Symbol

B4galnt1

Ensembl Gene

ENSMUSG00000006731

Gene Name

beta-1,4-N-acetyl-galactosaminyl transferase 1

Synonyms

Ggm2, Gal-NAc-T, GalNAcT, beta1,4GalNAC-T, GalNAc-T, Ggm-2, GM2/GD2 synthase, 4933429D13Rik, Galgt1

MMRRC Submission

041951-MU

Accession Numbers

Genbank: NM_008080; MGI: 1342057

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127165225-127172330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 127167525 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 172 (V172F)

Ref Sequence

ENSEMBL: ENSMUSP00000151229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]

Predicted Effect

probably benign
Transcript: ENSMUST00000006914
AA Change: V172F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731
AA Change: V172F

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
low complexity region	191	202	N/A	INTRINSIC
Pfam:Glycos_transf_2	280	450	7e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000095270

SMART Domains

Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

Domain	Start	End	E-Value	Type
low complexity region	51	78	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:Sulfate_transp	105	497	5.5e-103	PFAM
low complexity region	512	522	N/A	INTRINSIC
Pfam:STAS	549	664	3.3e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217678
AA Change: V172F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218977

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221174

Predicted Effect

probably benign
Transcript: ENSMUST00000222911

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one knock-out allele lack all complex gangliosides but show normal brain histology and gross behavior with only subtle defects in neural conduction velocities. Mice homozygous for another knock-out allele exhibit male infertility due to degeneration of the seminiferous tubules. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Dntt	T	A	19: 41,039,803	D179E	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Evpl	C	G	11: 116,222,505	R1453P	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ifih1	A	T	2: 62,598,876	L906H	probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Nsd1	T	A	13: 55,214,063	D281E	probably damaging	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in B4galnt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00858:B4galnt1	APN	10	127167764	missense	probably benign	0.01
IGL01087:B4galnt1	APN	10	127166191	missense	probably damaging	1.00
IGL01301:B4galnt1	APN	10	127169779	missense	possibly damaging	0.56
IGL01924:B4galnt1	APN	10	127166761	missense	probably benign	0.01
IGL02996:B4galnt1	APN	10	127167003	missense	probably damaging	1.00
Hypokalemic	UTSW	10	127171793	unclassified	probably null
ANU18:B4galnt1	UTSW	10	127169779	missense	possibly damaging	0.56
R0233:B4galnt1	UTSW	10	127170911	unclassified	probably benign
R4646:B4galnt1	UTSW	10	127167836	missense	probably damaging	0.99
R4702:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4705:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4708:B4galnt1	UTSW	10	127169815	missense	probably damaging	1.00
R5377:B4galnt1	UTSW	10	127171822	missense	possibly damaging	0.95
R6644:B4galnt1	UTSW	10	127171793	unclassified	probably null
R7006:B4galnt1	UTSW	10	127169831	missense	probably benign	0.00
R7278:B4galnt1	UTSW	10	127167788	missense	probably benign	0.01
R7396:B4galnt1	UTSW	10	127171616	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGCAGTCACTTGAGTTCTGTGG -3'
(R):5'- CGTGAGAGTCACTCCTGTTAC -3'

Sequencing Primer
(F):5'- GGTTGTGCACAGTCCTGC -3'
(R):5'- CAGGTGCCTAGAGAAGCACTC -3'

Posted On

2015-10-21