Incidental Mutation 'R4703:Limk2'
ID356230
Institutional Source Beutler Lab
Gene Symbol Limk2
Ensembl Gene ENSMUSG00000020451
Gene NameLIM motif-containing protein kinase 2
SynonymsLimk2a, A930024P04Rik, LIM kinase 2, Limk2b
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4703 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3344256-3409189 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 3347586 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 329 (E329*)
Ref Sequence ENSEMBL: ENSMUSP00000105656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045153] [ENSMUST00000101638] [ENSMUST00000101640] [ENSMUST00000101642] [ENSMUST00000110029]
Predicted Effect probably benign
Transcript: ENSMUST00000045153
SMART Domains Protein: ENSMUSP00000036921
Gene: ENSMUSG00000034614

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 3.64e-17 SMART
transmembrane domain 170 192 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101638
AA Change: E516*
SMART Domains Protein: ENSMUSP00000099162
Gene: ENSMUSG00000020451
AA Change: E516*

DomainStartEndE-ValueType
LIM 11 63 2e-14 SMART
LIM 71 124 4.63e-10 SMART
PDZ 161 239 7.04e-10 SMART
low complexity region 241 255 N/A INTRINSIC
low complexity region 280 306 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
Pfam:Pkinase 331 600 5.3e-48 PFAM
Pfam:Pkinase_Tyr 331 601 4.7e-50 PFAM
Pfam:Kdo 341 497 8.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101640
AA Change: E501*
SMART Domains Protein: ENSMUSP00000099163
Gene: ENSMUSG00000020451
AA Change: E501*

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 582 1.2e-45 PFAM
Pfam:Pkinase_Tyr 310 586 1.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101642
AA Change: E495*
SMART Domains Protein: ENSMUSP00000099165
Gene: ENSMUSG00000020451
AA Change: E495*

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 579 4.9e-48 PFAM
Pfam:Pkinase_Tyr 310 580 4.3e-50 PFAM
Pfam:Kdo 320 476 8.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110029
AA Change: E329*
SMART Domains Protein: ENSMUSP00000105656
Gene: ENSMUSG00000020451
AA Change: E329*

DomainStartEndE-ValueType
PDZ 1 52 4.55e-1 SMART
low complexity region 54 68 N/A INTRINSIC
low complexity region 93 119 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Pfam:Pkinase 144 411 2.7e-49 PFAM
Pfam:Pkinase_Tyr 144 414 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148771
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygotes for targeted null mutations exhibit small testes but are fertile. Mutant kidneys have fewer glomeruli and dilated renal tubules, but function normally. Mice homozygous for a gene trap allele or spontaneous mutation have open eyelids at birth, corneal abnormalities and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Ptpn21 T C 12: 98,679,392 T1096A probably benign Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Stxbp2 A G 8: 3,632,521 S37G probably damaging Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tcf4 A G 18: 69,657,910 Y307C probably damaging Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r59 T A 7: 42,012,262 I710L probably benign Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Limk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Limk2 APN 11 3355475 splice site probably benign
IGL01592:Limk2 APN 11 3359052 missense probably benign 0.00
IGL01716:Limk2 APN 11 3358990 splice site probably null
IGL01911:Limk2 APN 11 3355340 missense probably benign
R0900:Limk2 UTSW 11 3350731 missense probably damaging 1.00
R1587:Limk2 UTSW 11 3353455 missense possibly damaging 0.82
R1632:Limk2 UTSW 11 3346250 missense probably damaging 1.00
R1695:Limk2 UTSW 11 3353275 critical splice donor site probably null
R1712:Limk2 UTSW 11 3358104 splice site probably null
R1792:Limk2 UTSW 11 3358236 missense probably benign
R1982:Limk2 UTSW 11 3355461 missense probably benign 0.00
R3009:Limk2 UTSW 11 3359046 missense probably benign 0.01
R4565:Limk2 UTSW 11 3348634 missense probably damaging 0.98
R4978:Limk2 UTSW 11 3409069 utr 5 prime probably benign
R5160:Limk2 UTSW 11 3350772 missense probably damaging 1.00
R5460:Limk2 UTSW 11 3352332 missense probably benign 0.30
R6497:Limk2 UTSW 11 3360492 missense probably benign 0.00
R6543:Limk2 UTSW 11 3350682 missense probably damaging 1.00
R6666:Limk2 UTSW 11 3360493 missense probably damaging 1.00
R7054:Limk2 UTSW 11 3355448 missense possibly damaging 0.95
R7330:Limk2 UTSW 11 3346311 missense probably benign 0.39
R7681:Limk2 UTSW 11 3353354 missense probably damaging 0.96
R7722:Limk2 UTSW 11 3356092 utr 5 prime probably null
R7745:Limk2 UTSW 11 3355896 missense probably damaging 0.99
R8193:Limk2 UTSW 11 3347691 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GATTAAAAGTTTATGAGGCCTGGC -3'
(R):5'- TTGAAGGTGGCCTCTCTTGC -3'

Sequencing Primer
(F):5'- TGAAAGATCATCGGCCTC -3'
(R):5'- AAAGGCCTCCAGTAGAGA -3'
Posted On2015-10-21