Mutagenetix > Incidental Mutations

Incidental Mutation 'R4703:Evpl'

356234

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

MMRRC Submission

041951-MU

Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116220559-116238077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 116222505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 1453 (R1453P)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007] [ENSMUST00000174177]

AlphaFold

Q9D952

Predicted Effect

probably damaging
Transcript: ENSMUST00000037007
AA Change: R1453P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: R1453P

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173567

Predicted Effect

probably benign
Transcript: ENSMUST00000174177

SMART Domains

Protein: ENSMUSP00000134251
Gene: ENSMUSG00000092300

Domain	Start	End	E-Value	Type
S_TKc	4	285	4e-105	SMART

Meta Mutation Damage Score

0.1006

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Dntt	T	A	19: 41,039,803	D179E	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ifih1	A	T	2: 62,598,876	L906H	probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Nsd1	T	A	13: 55,214,063	D281E	probably damaging	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116234505	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116222584	nonsense	probably null
IGL00941:Evpl	APN	11	116227901	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116222454	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116233444	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116223222	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116227015	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116231024	nonsense	probably null
IGL02457:Evpl	APN	11	116230113	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116222718	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116221209	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116221822	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116221612	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116227927	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116220834	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
BB015:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116235003	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116220876	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116223291	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116229490	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116232485	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116230068	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116223835	missense	probably benign
R1699:Evpl	UTSW	11	116227588	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116225492	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116223660	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116227576	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116227028	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116234266	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116221839	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116237969	missense	unknown
R3081:Evpl	UTSW	11	116220852	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116223177	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116232644	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R4947:Evpl	UTSW	11	116223375	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116222969	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116221365	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116234259	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116234232	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116234432	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116230922	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116230101	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116222814	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116237906	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116222944	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116223807	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116223113	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116223949	missense	probably benign
R7395:Evpl	UTSW	11	116227079	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116222956	nonsense	probably null
R7505:Evpl	UTSW	11	116226987	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116222568	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116221435	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116234174	missense	not run
R7861:Evpl	UTSW	11	116228069	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116230472	missense	probably null	0.21
R8040:Evpl	UTSW	11	116222932	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116223163	missense	probably benign	0.00
R8402:Evpl	UTSW	11	116225371	missense	probably benign	0.03
R8513:Evpl	UTSW	11	116229744	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116223663	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116222193	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116229406	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116221027	missense	probably damaging	1.00
R8883:Evpl	UTSW	11	116230417	missense	probably damaging	0.99
R8947:Evpl	UTSW	11	116221338	missense	probably damaging	1.00
R9123:Evpl	UTSW	11	116224182	missense	possibly damaging	0.62
R9314:Evpl	UTSW	11	116227677	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TTTTCTGGAGGAGGTCGACC -3'
(R):5'- AAGTTACTGCTGCTGGAGAG -3'

Sequencing Primer
(F):5'- GTCGACCTGAACCTGCAGAC -3'
(R):5'- TGGTCACCCAGAAGGACC -3'

Posted On

2015-10-21