Mutagenetix > Incidental Mutations

Incidental Mutation 'R4703:Nsd1'

356240

Institutional Source

Beutler Lab

Gene Symbol

Nsd1

Ensembl Gene

ENSMUSG00000021488

Gene Name

nuclear receptor-binding SET-domain protein 1

Synonyms

KMT3B

MMRRC Submission

041951-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55209782-55318325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55214063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 281 (D281E)

Ref Sequence

ENSEMBL: ENSMUSP00000097089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224156] [ENSMUST00000224693] [ENSMUST00000224918] [ENSMUST00000224973] [ENSMUST00000225169]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099490
AA Change: D281E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: D281E

Domain	Start	End	E-Value	Type
low complexity region	177	187	N/A	INTRINSIC
low complexity region	281	289	N/A	INTRINSIC
PWWP	322	388	1.97e-3	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	980	1000	N/A	INTRINSIC
low complexity region	1296	1309	N/A	INTRINSIC
PHD	1546	1588	4.25e-8	SMART
PHD	1593	1640	3.79e-5	SMART
RING	1594	1639	1.08e-1	SMART
PHD	1641	1694	1.09e1	SMART
PHD	1710	1750	1.02e-10	SMART
PWWP	1755	1817	8.87e-29	SMART
AWS	1891	1942	3.02e-22	SMART
SET	1943	2066	1e-45	SMART
PostSET	2067	2083	3.99e-3	SMART
PHD	2121	2164	1.08e-9	SMART
low complexity region	2224	2237	N/A	INTRINSIC
low complexity region	2276	2286	N/A	INTRINSIC
low complexity region	2335	2356	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224156
AA Change: D11E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224338

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224693
AA Change: D11E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224918
AA Change: D11E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224973
AA Change: D281E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000225169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225194

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225982

Meta Mutation Damage Score

0.0839

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Dntt	T	A	19: 41,039,803	D179E	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Evpl	C	G	11: 116,222,505	R1453P	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ifih1	A	T	2: 62,598,876	L906H	probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in Nsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Nsd1	APN	13	55238735	missense	probably damaging	1.00
IGL01060:Nsd1	APN	13	55263429	missense	probably damaging	1.00
IGL01125:Nsd1	APN	13	55245617	missense	probably damaging	1.00
IGL01746:Nsd1	APN	13	55276515	splice site	probably null
IGL02437:Nsd1	APN	13	55313441	missense	probably damaging	1.00
IGL02530:Nsd1	APN	13	55302833	splice site	probably benign
IGL02557:Nsd1	APN	13	55312448	missense	probably damaging	1.00
IGL02572:Nsd1	APN	13	55296130	missense	probably damaging	1.00
IGL02665:Nsd1	APN	13	55296183	missense	probably damaging	1.00
IGL02870:Nsd1	APN	13	55313603	missense	probably benign	0.06
IGL03181:Nsd1	APN	13	55247045	missense	probably damaging	1.00
Amanuensis	UTSW	13	55261626	nonsense	probably null
Prothonotary	UTSW	13	55282757	missense	probably damaging	1.00
scribe	UTSW	13	55291236	missense	probably damaging	1.00
stenographer	UTSW	13	55298376	splice site	probably null
PIT4480001:Nsd1	UTSW	13	55213918	missense	probably benign	0.11
R0316:Nsd1	UTSW	13	55213771	missense	probably damaging	0.98
R0519:Nsd1	UTSW	13	55312835	missense	probably benign	0.04
R0542:Nsd1	UTSW	13	55260458	missense	possibly damaging	0.93
R0563:Nsd1	UTSW	13	55246578	missense	possibly damaging	0.48
R0652:Nsd1	UTSW	13	55247586	missense	possibly damaging	0.92
R0906:Nsd1	UTSW	13	55277590	missense	probably benign	0.30
R1560:Nsd1	UTSW	13	55246720	nonsense	probably null
R1572:Nsd1	UTSW	13	55246969	missense	probably damaging	0.98
R1693:Nsd1	UTSW	13	55247261	missense	probably benign
R1697:Nsd1	UTSW	13	55214059	critical splice acceptor site	probably null
R1720:Nsd1	UTSW	13	55246898	missense	probably damaging	0.98
R1829:Nsd1	UTSW	13	55246369	missense	probably damaging	1.00
R1834:Nsd1	UTSW	13	55313351	missense	possibly damaging	0.52
R1842:Nsd1	UTSW	13	55246445	missense	probably damaging	1.00
R1880:Nsd1	UTSW	13	55213793	missense	probably damaging	0.99
R2022:Nsd1	UTSW	13	55213279	missense	probably damaging	0.99
R2075:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R2143:Nsd1	UTSW	13	55260397	missense	probably damaging	1.00
R2151:Nsd1	UTSW	13	55291236	missense	probably damaging	1.00
R2316:Nsd1	UTSW	13	55233966	missense	probably damaging	1.00
R2359:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2361:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2656:Nsd1	UTSW	13	55246868	missense	probably damaging	1.00
R2849:Nsd1	UTSW	13	55213692	missense	probably damaging	0.99
R3237:Nsd1	UTSW	13	55312888	missense	possibly damaging	0.92
R3772:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3773:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3849:Nsd1	UTSW	13	55246691	missense	probably benign	0.00
R3951:Nsd1	UTSW	13	55268454	missense	probably benign	0.05
R4036:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R4073:Nsd1	UTSW	13	55247728	missense	probably benign	0.28
R4080:Nsd1	UTSW	13	55301809	missense	probably damaging	0.96
R4226:Nsd1	UTSW	13	55260401	missense	probably damaging	1.00
R4485:Nsd1	UTSW	13	55245621	missense	probably benign
R4853:Nsd1	UTSW	13	55268504	missense	probably benign	0.30
R4915:Nsd1	UTSW	13	55247868	missense	possibly damaging	0.65
R4915:Nsd1	UTSW	13	55276528	missense	probably benign	0.00
R5264:Nsd1	UTSW	13	55247346	missense	possibly damaging	0.49
R5348:Nsd1	UTSW	13	55312334	missense	probably benign	0.00
R5473:Nsd1	UTSW	13	55247772	missense	probably damaging	1.00
R5498:Nsd1	UTSW	13	55213302	nonsense	probably null
R5503:Nsd1	UTSW	13	55245939	missense	probably damaging	1.00
R5511:Nsd1	UTSW	13	55312730	missense	probably benign	0.00
R5683:Nsd1	UTSW	13	55246148	missense	probably benign	0.00
R5778:Nsd1	UTSW	13	55306979	missense	probably damaging	1.00
R5793:Nsd1	UTSW	13	55248006	missense	probably benign
R5922:Nsd1	UTSW	13	55247475	missense	probably benign	0.01
R5956:Nsd1	UTSW	13	55263404	missense	probably damaging	1.00
R6053:Nsd1	UTSW	13	55293609	missense	probably damaging	1.00
R6141:Nsd1	UTSW	13	55291284	missense	probably damaging	1.00
R6158:Nsd1	UTSW	13	55245621	missense	probably benign
R6224:Nsd1	UTSW	13	55313132	missense	possibly damaging	0.85
R6396:Nsd1	UTSW	13	55238789	missense	probably damaging	1.00
R6598:Nsd1	UTSW	13	55293702	missense	possibly damaging	0.94
R7170:Nsd1	UTSW	13	55261626	nonsense	probably null
R7205:Nsd1	UTSW	13	55246470	missense	probably damaging	1.00
R7215:Nsd1	UTSW	13	55247641	missense	probably benign	0.00
R7337:Nsd1	UTSW	13	55246209	missense	probably damaging	1.00
R7432:Nsd1	UTSW	13	55213374	missense	probably benign
R7638:Nsd1	UTSW	13	55312328	missense	probably benign	0.01
R7647:Nsd1	UTSW	13	55299835	missense	probably damaging	0.96
R7658:Nsd1	UTSW	13	55277639	missense	probably damaging	1.00
R7884:Nsd1	UTSW	13	55313255	missense	probably damaging	0.99
R8032:Nsd1	UTSW	13	55310383	missense	probably damaging	1.00
R8113:Nsd1	UTSW	13	55245621	missense	probably benign
R8152:Nsd1	UTSW	13	55310367	missense	possibly damaging	0.49
R8183:Nsd1	UTSW	13	55312373	missense	probably damaging	1.00
R8432:Nsd1	UTSW	13	55247703	missense	possibly damaging	0.91
R8462:Nsd1	UTSW	13	55298376	splice site	probably null
R8469:Nsd1	UTSW	13	55277553	missense	possibly damaging	0.76
R8756:Nsd1	UTSW	13	55313693	missense	probably benign	0.00
R8867:Nsd1	UTSW	13	55282757	missense	probably damaging	1.00
R9035:Nsd1	UTSW	13	55245854	missense	possibly damaging	0.79
R9101:Nsd1	UTSW	13	55313546	missense
R9154:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9155:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9262:Nsd1	UTSW	13	55247058	missense	possibly damaging	0.92
Z1088:Nsd1	UTSW	13	55213848	missense	possibly damaging	0.83
Z1176:Nsd1	UTSW	13	55245525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCATGCCAGAGAGTAGAC -3'
(R):5'- TTAGCTTCCACCTACAAACTGG -3'

Sequencing Primer
(F):5'- CATGGTGCAGTGGAACGGC -3'
(R):5'- GGAACCAAAGACAAATTAAAGTTTCC -3'

Posted On

2015-10-21