Mutagenetix > Incidental Mutation

Incidental Mutation 'R4703:Kalrn'

356247

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

041951-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34203957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 610 (D610G)

Ref Sequence

ENSEMBL: ENSMUSP00000110604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076810
AA Change: D1224G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: D1224G

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089655
AA Change: D1251G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: D1251G

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114947
AA Change: D597G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: D597G

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114949
AA Change: D601G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: D601G

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: D610G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: D610G

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: D610G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: D610G

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114960
AA Change: D1242G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: D1242G

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: D1219G

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: D1219G

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151491
AA Change: D998G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: D998G

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Meta Mutation Damage Score

0.3340

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Dntt	T	A	19: 41,039,803	D179E	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Evpl	C	G	11: 116,222,505	R1453P	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ifih1	A	T	2: 62,598,876	L906H	probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Nsd1	T	A	13: 55,214,063	D281E	probably damaging	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34175722	splice site	probably benign
IGL01364:Kalrn	APN	16	34262629	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34235330	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34294161	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34198512	splice site	probably null
IGL02059:Kalrn	APN	16	34252341	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34220222	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34310527	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34332224	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34360846	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34513959	nonsense	probably null
IGL02696:Kalrn	APN	16	34220114	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34392050	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34220130	nonsense	probably null
IGL03188:Kalrn	APN	16	34314192	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34385297	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34314176	missense	probably damaging	0.99
breeze	UTSW	16	34013675	missense
ethereal	UTSW	16	33975435	utr 3 prime	probably benign
Feather	UTSW	16	34314209	missense	probably damaging	0.99
Hidden	UTSW	16	34027976	missense	probably damaging	1.00
Soulful	UTSW	16	34187484	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34031582	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34198514	splice site	probably benign
R0043:Kalrn	UTSW	16	34054906	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34357171	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34031590	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34049936	intron	probably benign
R0183:Kalrn	UTSW	16	34171379	splice site	probably null
R0422:Kalrn	UTSW	16	34314273	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34054891	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33993670	splice site	probably benign
R0656:Kalrn	UTSW	16	34032467	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34116408	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34010581	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34035554	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34049919	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34385390	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34016498	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33988803	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34212820	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33975754	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34174487	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34314278	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34010548	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34360950	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34212873	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34294215	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34356961	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33975923	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33977524	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34028045	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34189736	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34252310	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34332143	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34332230	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34307724	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34009262	unclassified	probably benign
R2193:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34176262	splice site	probably null
R2404:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34310495	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34212272	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34357315	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34392030	splice site	probably null
R3788:Kalrn	UTSW	16	34220240	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34039889	nonsense	probably null
R3871:Kalrn	UTSW	16	34203856	splice site	probably null
R3934:Kalrn	UTSW	16	34310531	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34235391	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33987208	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34392042	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34235267	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34513926	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34028705	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34176391	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34198487	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34356969	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34514019	unclassified	probably benign
R4888:Kalrn	UTSW	16	34171330	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34357415	splice site	probably null
R5030:Kalrn	UTSW	16	33975742	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34314352	nonsense	probably null
R5117:Kalrn	UTSW	16	34033601	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34252341	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34262653	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34053622	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34175780	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34039934	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34014084	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34016579	missense	probably benign
R5716:Kalrn	UTSW	16	33987176	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33975820	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34212249	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33987091	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33975435	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34243833	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34357343	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34010580	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34360885	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33985191	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34212885	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34357111	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34053639	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34055071	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33975991	missense	probably benign
R6397:Kalrn	UTSW	16	33992985	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34332164	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34205302	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34360984	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34182747	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34217923	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34027976	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33975703	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34220136	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34357048	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34217891	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34256227	missense	unknown
R7154:Kalrn	UTSW	16	34212157	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34163077	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34176422	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34175761	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34256233	missense	unknown
R7563:Kalrn	UTSW	16	34392094	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34314212	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34031582	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34187484	nonsense	probably null
R7867:Kalrn	UTSW	16	33989791	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33988847	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34028752	missense	probably benign
R8080:Kalrn	UTSW	16	33975668	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34055044	missense	probably benign
R8239:Kalrn	UTSW	16	34049783	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34035061	nonsense	probably null
R8294:Kalrn	UTSW	16	34033584	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34360935	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34034514	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33982855	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34198460	missense	probably benign	0.05
R8878:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R8880:Kalrn	UTSW	16	34217935	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33993655	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34227126	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34034484	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34361001	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34013675	missense
R9424:Kalrn	UTSW	16	33988818	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34095879	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33985230	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34028827	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34212213	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34039933	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34035506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCAGGTAGACCAGATGACTC -3'
(R):5'- TTTGGCCAGAACAATCTACAGC -3'

Sequencing Primer
(F):5'- GGTAGACCAGATGACTCATCAAGC -3'
(R):5'- CTACAGCTTTTCTACTTGAGAGGCAG -3'

Posted On

2015-10-21