Incidental Mutation 'R4703:Tcf4'
ID356251
Institutional Source Beutler Lab
Gene Symbol Tcf4
Ensembl Gene ENSMUSG00000053477
Gene Nametranscription factor 4
SynonymsMITF-2B, ITF-2, MITF-2A, ME2, SEF2-1, 5730422P05Rik, ASP-I2, SEF-2, bHLHb19, TFE, E2.2, ITF-2b, E2-2
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4703 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location69343356-69689079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69657910 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 307 (Y307C)
Ref Sequence ENSEMBL: ENSMUSP00000143857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066717] [ENSMUST00000078486] [ENSMUST00000114977] [ENSMUST00000114978] [ENSMUST00000114980] [ENSMUST00000114982] [ENSMUST00000114985] [ENSMUST00000200703] [ENSMUST00000200862] [ENSMUST00000201037] [ENSMUST00000201091] [ENSMUST00000201094] [ENSMUST00000201205] [ENSMUST00000201410] [ENSMUST00000201631] [ENSMUST00000201781] [ENSMUST00000201964] [ENSMUST00000202057] [ENSMUST00000202116] [ENSMUST00000202354] [ENSMUST00000202435] [ENSMUST00000202458] [ENSMUST00000202474] [ENSMUST00000202477] [ENSMUST00000202610] [ENSMUST00000202674] [ENSMUST00000202751] [ENSMUST00000202772] [ENSMUST00000202937] [ENSMUST00000209116]
Predicted Effect probably damaging
Transcript: ENSMUST00000066717
AA Change: Y458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067318
Gene: ENSMUSG00000053477
AA Change: Y458C

DomainStartEndE-ValueType
low complexity region 244 252 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
HLH 595 648 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078486
AA Change: Y436C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077577
Gene: ENSMUSG00000053477
AA Change: Y436C

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114977
AA Change: Y277C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110628
Gene: ENSMUSG00000053477
AA Change: Y277C

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114978
AA Change: Y277C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110629
Gene: ENSMUSG00000053477
AA Change: Y277C

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 383 N/A INTRINSIC
HLH 414 467 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114980
AA Change: Y436C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110631
Gene: ENSMUSG00000053477
AA Change: Y436C

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114982
AA Change: Y436C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110633
Gene: ENSMUSG00000053477
AA Change: Y436C

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114985
AA Change: Y436C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110636
Gene: ENSMUSG00000053477
AA Change: Y436C

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200703
SMART Domains Protein: ENSMUSP00000144583
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200862
AA Change: Y307C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144338
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201037
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144488
Gene: ENSMUSG00000053477
AA Change: Y197C

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
low complexity region 191 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201081
Predicted Effect probably benign
Transcript: ENSMUST00000201091
SMART Domains Protein: ENSMUSP00000144386
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201094
AA Change: Y307C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144169
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201157
Predicted Effect probably damaging
Transcript: ENSMUST00000201205
AA Change: Y307C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144273
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201410
AA Change: Y307C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143950
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201631
AA Change: Y412C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144285
Gene: ENSMUSG00000053477
AA Change: Y412C

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
HLH 545 598 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201781
AA Change: Y412C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144209
Gene: ENSMUSG00000053477
AA Change: Y412C

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201964
SMART Domains Protein: ENSMUSP00000144070
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202057
AA Change: Y307C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144647
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202116
AA Change: Y436C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144512
Gene: ENSMUSG00000053477
AA Change: Y436C

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202354
AA Change: Y411C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144646
Gene: ENSMUSG00000053477
AA Change: Y411C

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202435
AA Change: Y412C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144407
Gene: ENSMUSG00000053477
AA Change: Y412C

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202458
AA Change: Y357C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143875
Gene: ENSMUSG00000053477
AA Change: Y357C

DomainStartEndE-ValueType
low complexity region 143 151 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 387 400 N/A INTRINSIC
low complexity region 423 441 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
HLH 490 543 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202474
AA Change: Y277C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143820
Gene: ENSMUSG00000053477
AA Change: Y277C

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202477
AA Change: Y307C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144219
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202610
AA Change: Y376C

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144670
Gene: ENSMUSG00000053477
AA Change: Y376C

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 482 N/A INTRINSIC
HLH 513 566 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202674
AA Change: Y411C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144221
Gene: ENSMUSG00000053477
AA Change: Y411C

DomainStartEndE-ValueType
low complexity region 197 205 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202751
SMART Domains Protein: ENSMUSP00000144064
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202772
AA Change: Y376C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143987
Gene: ENSMUSG00000053477
AA Change: Y376C

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 485 N/A INTRINSIC
HLH 509 562 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202937
AA Change: Y307C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143857
Gene: ENSMUSG00000053477
AA Change: Y307C

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209116
Meta Mutation Damage Score 0.7404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show a partial block in early thymopoiesis, increased double-negative T cell count, and increased sensitivity to anti-CD3 induced apoptosis. Homozygotes for another null allele show neonatal or postnatal lethality, reduced pro-B cell number, and abnormal pontine nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Limk2 C A 11: 3,347,586 E329* probably null Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Ptpn21 T C 12: 98,679,392 T1096A probably benign Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Stxbp2 A G 8: 3,632,521 S37G probably damaging Het
Tbxas1 T C 6: 39,083,857 probably null Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r59 T A 7: 42,012,262 I710L probably benign Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Tcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Tcf4 APN 18 69655019 missense probably damaging 1.00
IGL02131:Tcf4 APN 18 69564626 splice site probably benign
IGL02221:Tcf4 APN 18 69347367 missense probably damaging 1.00
IGL02420:Tcf4 APN 18 69564139 missense probably damaging 1.00
IGL02560:Tcf4 APN 18 69643022 unclassified probably benign
IGL02637:Tcf4 APN 18 69347350 missense probably damaging 1.00
IGL03056:Tcf4 APN 18 69651212 splice site probably benign
R0374:Tcf4 UTSW 18 69681812 splice site probably benign
R1265:Tcf4 UTSW 18 69642932 missense possibly damaging 0.93
R1739:Tcf4 UTSW 18 69642970 missense probably damaging 1.00
R1794:Tcf4 UTSW 18 69657853 missense probably benign 0.44
R4735:Tcf4 UTSW 18 69564155 missense possibly damaging 0.59
R4993:Tcf4 UTSW 18 69681769 missense probably damaging 1.00
R5191:Tcf4 UTSW 18 69642883 missense probably damaging 1.00
R5318:Tcf4 UTSW 18 69465430 missense possibly damaging 0.90
R5634:Tcf4 UTSW 18 69636847 missense possibly damaging 0.88
R6337:Tcf4 UTSW 18 69633580 missense probably damaging 1.00
R6658:Tcf4 UTSW 18 69657802 missense probably null 1.00
R6868:Tcf4 UTSW 18 69657650 intron probably null
R6907:Tcf4 UTSW 18 69652413 missense probably damaging 1.00
R7170:Tcf4 UTSW 18 69633578 missense probably damaging 1.00
R7235:Tcf4 UTSW 18 69657795 missense probably damaging 1.00
R7431:Tcf4 UTSW 18 69347178 intron probably null
R7589:Tcf4 UTSW 18 69682819 makesense probably null
R7606:Tcf4 UTSW 18 69642983 missense probably damaging 0.99
R7796:Tcf4 UTSW 18 69564069 missense probably benign 0.02
R8193:Tcf4 UTSW 18 69500923 start gained probably benign
Z1176:Tcf4 UTSW 18 69593380 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAGGATTCTGCTTTGTG -3'
(R):5'- GCCACTCAACCAACTGTGTG -3'

Sequencing Primer
(F):5'- TGCATGCATTTCCAACTAAATCCG -3'
(R):5'- CTCTCTTTGTACATGAGGCGAAAC -3'
Posted On2015-10-21