Mutagenetix > Incidental Mutations

Incidental Mutation 'R4703:Dntt'

356256

Institutional Source

Beutler Lab

Gene Symbol

Dntt

Ensembl Gene

ENSMUSG00000025014

Gene Name

deoxynucleotidyltransferase, terminal

Synonyms

Tdt

MMRRC Submission

041951-MU

Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41029275-41059523 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41039803 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 179 (D179E)

Ref Sequence

ENSEMBL: ENSMUSP00000107819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]

Predicted Effect

probably benign
Transcript: ENSMUST00000051806
AA Change: D179E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: D179E

Domain	Start	End	E-Value	Type
BRCT	29	114	3.05e-9	SMART
POLXc	163	529	5.68e-196	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112200
AA Change: D179E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: D179E

Domain	Start	End	E-Value	Type
BRCT	29	114	3.05e-9	SMART
POLXc	163	509	1.19e-198	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	A	13: 59,689,528	T248S	possibly damaging	Het
AA986860	T	C	1: 130,743,355	V438A	probably benign	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Aox2	T	A	1: 58,358,957	F1286I	possibly damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgap5	C	T	12: 52,517,583	P446S	probably damaging	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Armc12	A	G	17: 28,532,362	D110G	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
B4galt1	A	G	4: 40,823,569	V174A	probably benign	Het
Bcl11a	C	A	11: 24,163,725	A356E	possibly damaging	Het
Bri3bp	C	T	5: 125,451,766	L110F	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Ccdc33	T	A	9: 58,033,670	I430F	possibly damaging	Het
Cgn	A	G	3: 94,776,095		probably benign	Het
Crbn	T	A	6: 106,782,922	I317F	possibly damaging	Het
Cyp2d22	A	C	15: 82,375,917	L22R	probably damaging	Het
Dnah7a	C	T	1: 53,447,317		probably null	Het
Dnajc12	A	G	10: 63,386,650		probably null	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Epn1	T	A	7: 5,095,148	D319E	probably damaging	Het
Evpl	C	G	11: 116,222,505	R1453P	probably damaging	Het
Focad	T	A	4: 88,342,321		probably null	Het
Foxp2	A	T	6: 15,411,248	M542L	probably benign	Het
Gak	T	A	5: 108,569,877	Q1299L	probably damaging	Het
Galnt5	G	T	2: 57,998,907	R173I	possibly damaging	Het
Gli1	G	T	10: 127,330,855	P843Q	possibly damaging	Het
Gm5422	G	T	10: 31,249,612		noncoding transcript	Het
Gna14	T	G	19: 16,598,980	V117G	possibly damaging	Het
Gpr6	T	C	10: 41,071,041	T182A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ifih1	A	T	2: 62,598,876	L906H	probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Ighd	A	G	12: 113,416,041		probably benign	Het
Ighv11-1	A	C	12: 113,982,002	I77R	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Il23r	A	T	6: 67,490,702	I27K	probably damaging	Het
Inpp5a	A	C	7: 139,558,923	N261T	probably damaging	Het
Ints8	T	G	4: 11,223,785	Q686P	possibly damaging	Het
Iqcf4	T	C	9: 106,568,320		probably null	Het
Irf2bp1	C	T	7: 19,005,571	R379C	possibly damaging	Het
Iws1	C	T	18: 32,080,013	P165S	probably benign	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kcna10	A	T	3: 107,194,610	I186F	probably benign	Het
Limk2	C	A	11: 3,347,586	E329*	probably null	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Notch1	T	G	2: 26,471,158	K1107Q	probably benign	Het
Nsd1	T	A	13: 55,214,063	D281E	probably damaging	Het
Olfml2a	T	A	2: 38,951,238	L262Q	probably damaging	Het
Olfr1294	T	A	2: 111,537,768	I174L	probably benign	Het
Olfr231	A	G	1: 174,117,398	I206T	possibly damaging	Het
Olfr371	A	G	8: 85,230,608	T38A	possibly damaging	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr557	A	T	7: 102,698,270	T11S	probably benign	Het
Otogl	A	C	10: 107,821,924	D1048E	probably damaging	Het
Oxnad1	T	C	14: 32,095,470	W96R	probably damaging	Het
Pcdh15	A	T	10: 74,450,163	D743V	probably damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcnx	C	T	12: 81,895,164	T112I	probably benign	Het
Pctp	T	C	11: 89,987,273	E145G	possibly damaging	Het
Pip5k1b	T	C	19: 24,355,153	K389R	probably damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Pnlip	T	A	19: 58,676,467	D242E	probably damaging	Het
Ptpn21	T	C	12: 98,679,392	T1096A	probably benign	Het
Rims3	A	T	4: 120,883,297		probably benign	Het
Rnf219	A	G	14: 104,506,208	L145P	probably benign	Het
Scfd2	T	A	5: 74,519,595	Q299L	probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Slc15a5	T	C	6: 138,055,645	D237G	probably benign	Het
Slc16a12	T	A	19: 34,674,891	H285L	possibly damaging	Het
Sox2	C	A	3: 34,650,713	R100S	probably damaging	Het
Sspo	G	A	6: 48,500,453	C4969Y	probably damaging	Het
Stxbp2	A	G	8: 3,632,521	S37G	probably damaging	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tcf4	A	G	18: 69,657,910	Y307C	probably damaging	Het
Thsd7b	A	T	1: 130,049,909		probably benign	Het
Tnn	G	T	1: 160,116,245	D999E	possibly damaging	Het
Trmt13	C	A	3: 116,594,598	W63L	probably benign	Het
Tsc2	T	C	17: 24,604,909	N915S	probably benign	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Uvrag	A	T	7: 98,989,587	I315N	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Vmn2r59	T	A	7: 42,012,262	I710L	probably benign	Het
Vmn2r82	A	T	10: 79,378,807	H208L	probably damaging	Het
Wtap	T	C	17: 12,980,824	T91A	probably benign	Het
Xirp1	A	T	9: 120,017,027	V930E	probably damaging	Het
Xpo4	T	G	14: 57,590,108	H877P	probably benign	Het

Other mutations in Dntt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Dntt	APN	19	41039823	missense	probably benign	0.01
IGL01531:Dntt	APN	19	41053238	nonsense	probably null
IGL01859:Dntt	APN	19	41037304	missense	probably benign
IGL02053:Dntt	APN	19	41046274	missense	probably benign	0.00
IGL02411:Dntt	APN	19	41052985	splice site	probably null
IGL03180:Dntt	APN	19	41029551	missense	probably benign	0.09
R0106:Dntt	UTSW	19	41055746	splice site	probably benign
R0122:Dntt	UTSW	19	41053038	missense	possibly damaging	0.95
R0194:Dntt	UTSW	19	41038970	missense	possibly damaging	0.90
R0266:Dntt	UTSW	19	41059127	missense	probably damaging	0.99
R0377:Dntt	UTSW	19	41047627	nonsense	probably null
R0412:Dntt	UTSW	19	41042933	missense	probably damaging	1.00
R0604:Dntt	UTSW	19	41053149	missense	probably benign	0.01
R1350:Dntt	UTSW	19	41037139	splice site	probably benign
R1577:Dntt	UTSW	19	41055785	missense	probably damaging	1.00
R1677:Dntt	UTSW	19	41029484	missense	probably benign	0.26
R2567:Dntt	UTSW	19	41041336	missense	possibly damaging	0.81
R4380:Dntt	UTSW	19	41053233	missense	probably damaging	1.00
R4999:Dntt	UTSW	19	41039856	missense	probably damaging	0.99
R6257:Dntt	UTSW	19	41053062	missense	probably damaging	1.00
R6757:Dntt	UTSW	19	41037162	missense	probably damaging	1.00
R7340:Dntt	UTSW	19	41058565	critical splice acceptor site	probably null
R7388:Dntt	UTSW	19	41038979	missense	probably benign	0.01
R7553:Dntt	UTSW	19	41029487	missense	probably damaging	0.99
R7806:Dntt	UTSW	19	41029632	missense	probably benign	0.02
YA93:Dntt	UTSW	19	41053187	missense	probably benign
Z1177:Dntt	UTSW	19	41055815	missense	not run

Predicted Primers

PCR Primer
(F):5'- GTTCAGTGACAGAGTCCCACAG -3'
(R):5'- GAGGAGAGAGCCCATACTTATGC -3'

Sequencing Primer
(F):5'- CCACAGGGGAGGATGCAAAG -3'
(R):5'- GAGAGCCCATACTTATGCGATCTG -3'

Posted On

2015-10-21