Mutagenetix > Incidental Mutation

Incidental Mutation 'R4704:Szt2'

356270

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

041952-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R4704 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118393829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 361 (Y361H)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075406
AA Change: Y361H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: Y361H

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136737

Meta Mutation Damage Score

0.0798

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	T	7: 131,357,530	M147K	probably damaging	Het
Abca13	A	G	11: 9,276,990	D582G	possibly damaging	Het
Abca2	T	C	2: 25,443,412	L1683P	probably damaging	Het
Adam39	A	G	8: 40,825,796	H408R	probably benign	Het
Adcy4	A	G	14: 55,775,025	S554P	possibly damaging	Het
Ahnak	T	G	19: 9,012,258		probably benign	Het
Ahnak	T	C	19: 9,013,181	I3943T	probably damaging	Het
Alkal2	T	A	12: 30,887,196	S109R	probably damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Arpc3	A	G	5: 122,400,408	M1V	probably null	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Ascc3	A	G	10: 50,659,014	I668V	probably benign	Het
Bdnf	T	A	2: 109,723,692	M137K	possibly damaging	Het
C87977	A	T	4: 144,208,592	I193N	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Cds2	T	A	2: 132,300,602	Y239*	probably null	Het
Cpped1	G	A	16: 11,885,629		probably benign	Het
Ctu2	G	A	8: 122,479,303	R261Q	probably damaging	Het
Cux1	A	G	5: 136,249,201	V645A	probably benign	Het
Cyp4f13	A	G	17: 32,925,735	C401R	probably damaging	Het
Dpt	T	G	1: 164,818,949	Y162*	probably null	Het
Ednra	A	G	8: 77,667,963		probably benign	Het
Eepd1	A	G	9: 25,482,826	T129A	probably benign	Het
Eif2s1	A	G	12: 78,877,170	T134A	probably benign	Het
Eloa	A	G	4: 136,011,214	V145A	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Eng	T	C	2: 32,678,912	S484P	probably benign	Het
Eogt	A	T	6: 97,113,852	V442E	probably damaging	Het
Fam185a	C	T	5: 21,480,473		probably benign	Het
Gm4922	C	T	10: 18,784,819	V52I	probably benign	Het
Gnao1	A	G	8: 93,811,376	E14G	probably benign	Het
Gpr75	C	A	11: 30,891,110	A5D	probably benign	Het
Hbq1b	T	A	11: 32,287,448		probably benign	Het
Hdac7	G	A	15: 97,796,216	T724M	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Irak4	A	G	15: 94,566,900		probably null	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kifc2	T	C	15: 76,662,977		probably null	Het
Kmt2c	G	A	5: 25,314,027	Q2362*	probably null	Het
Kntc1	G	A	5: 123,811,433	E1956K	probably damaging	Het
Lama3	T	C	18: 12,553,223	V2781A	probably benign	Het
Lipt2	A	G	7: 100,160,327	E207G	probably damaging	Het
Mag	A	T	7: 30,909,173	L172Q	probably damaging	Het
Map1b	A	T	13: 99,430,475	C1913S	unknown	Het
Mical3	A	G	6: 120,958,688	S1626P	probably benign	Het
Mslnl	G	T	17: 25,738,978	W65L	possibly damaging	Het
Muc20	G	T	16: 32,779,074	A3332S	possibly damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Nkx2-3	G	A	19: 43,612,684	E62K	probably damaging	Het
Olfr791	T	C	10: 129,526,302	L25P	possibly damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcna-ps2	T	A	19: 9,283,422	V15E	possibly damaging	Het
Plekhg3	G	T	12: 76,578,238	G1285W	probably damaging	Het
Procr	A	G	2: 155,754,338	S142G	probably damaging	Het
Ptpn3	A	T	4: 57,270,119	N14K	possibly damaging	Het
Rin1	C	A	19: 5,054,990	L693I	probably damaging	Het
Ripk4	C	A	16: 97,746,004	E290*	probably null	Het
Rnf213	A	G	11: 119,440,349	Y2128C	probably damaging	Het
Saal1	T	C	7: 46,699,740		probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Serpinf1	C	A	11: 75,411,041	A263S	probably damaging	Het
Sgo2b	A	T	8: 63,927,790	D669E	probably damaging	Het
Slc30a9	T	C	5: 67,342,273		probably benign	Het
Sri	A	T	5: 8,062,430		probably null	Het
Sspo	G	A	6: 48,498,704	C4918Y	probably damaging	Het
Tbc1d12	T	A	19: 38,901,337	W404R	probably damaging	Het
Tcf20	T	C	15: 82,851,727	E1841G	possibly damaging	Het
Tep1	T	C	14: 50,837,073	T1832A	probably benign	Het
Tmem132e	G	A	11: 82,443,531	A623T	probably damaging	Het
Tmem201	A	T	4: 149,727,317	F357Y	possibly damaging	Het
Trappc13	T	G	13: 104,166,821		probably benign	Het
Trav6-5	C	T	14: 53,491,426	Q47*	probably null	Het
Ubxn1	T	A	19: 8,872,035	D47E	probably benign	Het
Vmn2r45	G	T	7: 8,483,536	S251*	probably null	Het
Wnk1	A	G	6: 119,965,744	L774S	possibly damaging	Het
Zfp189	T	C	4: 49,530,081	S395P	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCGTTAAACAAGCGGTG -3'
(R):5'- GCTTTGGTCACGTGCCTAAC -3'

Sequencing Primer
(F):5'- CCTAGAGGACCCATGAGGATG -3'
(R):5'- CCTAACGTGGAGTTGATGAAGTTC -3'

Posted On

2015-10-21