Mutagenetix > Incidental Mutation

Incidental Mutation 'R4704:Map1b'

356316

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

041952-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4704 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99430475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1913 (C1913S)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: C1913S

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: C1913S

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	T	7: 131,357,530	M147K	probably damaging	Het
Abca13	A	G	11: 9,276,990	D582G	possibly damaging	Het
Abca2	T	C	2: 25,443,412	L1683P	probably damaging	Het
Adam39	A	G	8: 40,825,796	H408R	probably benign	Het
Adcy4	A	G	14: 55,775,025	S554P	possibly damaging	Het
Ahnak	T	G	19: 9,012,258		probably benign	Het
Ahnak	T	C	19: 9,013,181	I3943T	probably damaging	Het
Alkal2	T	A	12: 30,887,196	S109R	probably damaging	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Arhgef40	A	G	14: 52,002,310	N1327S	probably damaging	Het
Arpc3	A	G	5: 122,400,408	M1V	probably null	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Ascc3	A	G	10: 50,659,014	I668V	probably benign	Het
Bdnf	T	A	2: 109,723,692	M137K	possibly damaging	Het
C87977	A	T	4: 144,208,592	I193N	probably damaging	Het
Cacna1b	T	C	2: 24,654,463	D1231G	probably damaging	Het
Cds2	T	A	2: 132,300,602	Y239*	probably null	Het
Cpped1	G	A	16: 11,885,629		probably benign	Het
Ctu2	G	A	8: 122,479,303	R261Q	probably damaging	Het
Cux1	A	G	5: 136,249,201	V645A	probably benign	Het
Cyp4f13	A	G	17: 32,925,735	C401R	probably damaging	Het
Dpt	T	G	1: 164,818,949	Y162*	probably null	Het
Ednra	A	G	8: 77,667,963		probably benign	Het
Eepd1	A	G	9: 25,482,826	T129A	probably benign	Het
Eif2s1	A	G	12: 78,877,170	T134A	probably benign	Het
Eloa	A	G	4: 136,011,214	V145A	probably benign	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Eng	T	C	2: 32,678,912	S484P	probably benign	Het
Eogt	A	T	6: 97,113,852	V442E	probably damaging	Het
Fam185a	C	T	5: 21,480,473		probably benign	Het
Gm4922	C	T	10: 18,784,819	V52I	probably benign	Het
Gnao1	A	G	8: 93,811,376	E14G	probably benign	Het
Gpr75	C	A	11: 30,891,110	A5D	probably benign	Het
Hbq1b	T	A	11: 32,287,448		probably benign	Het
Hdac7	G	A	15: 97,796,216	T724M	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Ift88	A	G	14: 57,480,850		probably benign	Het
Irak4	A	G	15: 94,566,900		probably null	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kifc2	T	C	15: 76,662,977		probably null	Het
Kmt2c	G	A	5: 25,314,027	Q2362*	probably null	Het
Kntc1	G	A	5: 123,811,433	E1956K	probably damaging	Het
Lama3	T	C	18: 12,553,223	V2781A	probably benign	Het
Lipt2	A	G	7: 100,160,327	E207G	probably damaging	Het
Mag	A	T	7: 30,909,173	L172Q	probably damaging	Het
Mical3	A	G	6: 120,958,688	S1626P	probably benign	Het
Mslnl	G	T	17: 25,738,978	W65L	possibly damaging	Het
Muc20	G	T	16: 32,779,074	A3332S	possibly damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Nkx2-3	G	A	19: 43,612,684	E62K	probably damaging	Het
Olfr791	T	C	10: 129,526,302	L25P	possibly damaging	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pcna-ps2	T	A	19: 9,283,422	V15E	possibly damaging	Het
Plekhg3	G	T	12: 76,578,238	G1285W	probably damaging	Het
Procr	A	G	2: 155,754,338	S142G	probably damaging	Het
Ptpn3	A	T	4: 57,270,119	N14K	possibly damaging	Het
Rin1	C	A	19: 5,054,990	L693I	probably damaging	Het
Ripk4	C	A	16: 97,746,004	E290*	probably null	Het
Rnf213	A	G	11: 119,440,349	Y2128C	probably damaging	Het
Saal1	T	C	7: 46,699,740		probably benign	Het
Selplg	T	C	5: 113,819,033	D404G	probably benign	Het
Serpinf1	C	A	11: 75,411,041	A263S	probably damaging	Het
Sgo2b	A	T	8: 63,927,790	D669E	probably damaging	Het
Slc30a9	T	C	5: 67,342,273		probably benign	Het
Sri	A	T	5: 8,062,430		probably null	Het
Sspo	G	A	6: 48,498,704	C4918Y	probably damaging	Het
Szt2	A	G	4: 118,393,829	Y361H	probably damaging	Het
Tbc1d12	T	A	19: 38,901,337	W404R	probably damaging	Het
Tcf20	T	C	15: 82,851,727	E1841G	possibly damaging	Het
Tep1	T	C	14: 50,837,073	T1832A	probably benign	Het
Tmem132e	G	A	11: 82,443,531	A623T	probably damaging	Het
Tmem201	A	T	4: 149,727,317	F357Y	possibly damaging	Het
Trappc13	T	G	13: 104,166,821		probably benign	Het
Trav6-5	C	T	14: 53,491,426	Q47*	probably null	Het
Ubxn1	T	A	19: 8,872,035	D47E	probably benign	Het
Vmn2r45	G	T	7: 8,483,536	S251*	probably null	Het
Wnk1	A	G	6: 119,965,744	L774S	possibly damaging	Het
Zfp189	T	C	4: 49,530,081	S395P	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GGTGTAGCCGCTTACTTCAG -3'
(R):5'- CAATGCAACATCATCTGGCC -3'

Sequencing Primer
(F):5'- TAGCCGCTTACTTCAGGGGTC -3'
(R):5'- GCAACATCATCTGGCCTTGAATAGAG -3'

Posted On

2015-10-21