Incidental Mutation 'R4704:Mslnl'
ID 356330
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 041952-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4704 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25957952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 65 (W65L)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect possibly damaging
Transcript: ENSMUST00000047098
AA Change: W65L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: W65L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Meta Mutation Damage Score 0.2701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 130,959,259 (GRCm39) M147K probably damaging Het
Abca13 A G 11: 9,226,990 (GRCm39) D582G possibly damaging Het
Abca2 T C 2: 25,333,424 (GRCm39) L1683P probably damaging Het
Adam39 A G 8: 41,278,833 (GRCm39) H408R probably benign Het
Adcy4 A G 14: 56,012,482 (GRCm39) S554P possibly damaging Het
Ahnak T C 19: 8,990,545 (GRCm39) I3943T probably damaging Het
Ahnak T G 19: 8,989,622 (GRCm39) probably benign Het
Alkal2 T A 12: 30,937,195 (GRCm39) S109R probably damaging Het
Apobec4 A G 1: 152,632,001 (GRCm39) T10A probably benign Het
Arhgef40 A G 14: 52,239,767 (GRCm39) N1327S probably damaging Het
Arpc3 A G 5: 122,538,471 (GRCm39) M1V probably null Het
Ascc1 A G 10: 59,885,624 (GRCm39) Y225C probably damaging Het
Ascc3 A G 10: 50,535,110 (GRCm39) I668V probably benign Het
Bdnf T A 2: 109,554,037 (GRCm39) M137K possibly damaging Het
Cacna1b T C 2: 24,544,475 (GRCm39) D1231G probably damaging Het
Cds2 T A 2: 132,142,522 (GRCm39) Y239* probably null Het
Cpped1 G A 16: 11,703,493 (GRCm39) probably benign Het
Ctu2 G A 8: 123,206,042 (GRCm39) R261Q probably damaging Het
Cux1 A G 5: 136,278,055 (GRCm39) V645A probably benign Het
Cyp4f13 A G 17: 33,144,709 (GRCm39) C401R probably damaging Het
Dpt T G 1: 164,646,518 (GRCm39) Y162* probably null Het
Ednra A G 8: 78,394,592 (GRCm39) probably benign Het
Eepd1 A G 9: 25,394,122 (GRCm39) T129A probably benign Het
Eif2s1 A G 12: 78,923,944 (GRCm39) T134A probably benign Het
Eloa A G 4: 135,738,525 (GRCm39) V145A probably benign Het
Enam T A 5: 88,651,650 (GRCm39) L1053* probably null Het
Eng T C 2: 32,568,924 (GRCm39) S484P probably benign Het
Eogt A T 6: 97,090,813 (GRCm39) V442E probably damaging Het
Fam185a C T 5: 21,685,471 (GRCm39) probably benign Het
Gm4922 C T 10: 18,660,567 (GRCm39) V52I probably benign Het
Gnao1 A G 8: 94,538,004 (GRCm39) E14G probably benign Het
Gpr75 C A 11: 30,841,110 (GRCm39) A5D probably benign Het
Hbq1b T A 11: 32,237,448 (GRCm39) probably benign Het
Hdac7 G A 15: 97,694,097 (GRCm39) T724M probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Ift88 A G 14: 57,718,307 (GRCm39) probably benign Het
Irak4 A G 15: 94,464,781 (GRCm39) probably null Het
Kalrn T C 16: 34,024,327 (GRCm39) D610G probably damaging Het
Kifc2 T C 15: 76,547,177 (GRCm39) probably null Het
Kmt2c G A 5: 25,519,025 (GRCm39) Q2362* probably null Het
Kntc1 G A 5: 123,949,496 (GRCm39) E1956K probably damaging Het
Lama3 T C 18: 12,686,280 (GRCm39) V2781A probably benign Het
Lipt2 A G 7: 99,809,534 (GRCm39) E207G probably damaging Het
Mag A T 7: 30,608,598 (GRCm39) L172Q probably damaging Het
Map1b A T 13: 99,566,983 (GRCm39) C1913S unknown Het
Mical3 A G 6: 120,935,649 (GRCm39) S1626P probably benign Het
Muc20 G T 16: 32,599,448 (GRCm39) A3332S possibly damaging Het
Nadk C A 4: 155,669,684 (GRCm39) P157T probably benign Het
Nkx2-3 G A 19: 43,601,123 (GRCm39) E62K probably damaging Het
Or6c2 T C 10: 129,362,171 (GRCm39) L25P possibly damaging Het
Pclo A G 5: 14,726,494 (GRCm39) probably benign Het
Pcna-ps2 T A 19: 9,260,786 (GRCm39) V15E possibly damaging Het
Plekhg3 G T 12: 76,625,012 (GRCm39) G1285W probably damaging Het
Pramel29 A T 4: 143,935,162 (GRCm39) I193N probably damaging Het
Procr A G 2: 155,596,258 (GRCm39) S142G probably damaging Het
Ptpn3 A T 4: 57,270,119 (GRCm39) N14K possibly damaging Het
Rin1 C A 19: 5,105,018 (GRCm39) L693I probably damaging Het
Ripk4 C A 16: 97,547,204 (GRCm39) E290* probably null Het
Rnf213 A G 11: 119,331,175 (GRCm39) Y2128C probably damaging Het
Saal1 T C 7: 46,349,164 (GRCm39) probably benign Het
Selplg T C 5: 113,957,094 (GRCm39) D404G probably benign Het
Serpinf1 C A 11: 75,301,867 (GRCm39) A263S probably damaging Het
Sgo2b A T 8: 64,380,824 (GRCm39) D669E probably damaging Het
Slc30a9 T C 5: 67,499,616 (GRCm39) probably benign Het
Sri A T 5: 8,112,430 (GRCm39) probably null Het
Sspo G A 6: 48,475,638 (GRCm39) C4918Y probably damaging Het
Szt2 A G 4: 118,251,026 (GRCm39) Y361H probably damaging Het
Tbc1d12 T A 19: 38,889,781 (GRCm39) W404R probably damaging Het
Tcf20 T C 15: 82,735,928 (GRCm39) E1841G possibly damaging Het
Tep1 T C 14: 51,074,530 (GRCm39) T1832A probably benign Het
Tmem132e G A 11: 82,334,357 (GRCm39) A623T probably damaging Het
Tmem201 A T 4: 149,811,774 (GRCm39) F357Y possibly damaging Het
Trappc13 T G 13: 104,303,329 (GRCm39) probably benign Het
Trav6-5 C T 14: 53,728,883 (GRCm39) Q47* probably null Het
Ubxn1 T A 19: 8,849,399 (GRCm39) D47E probably benign Het
Vmn2r45 G T 7: 8,486,535 (GRCm39) S251* probably null Het
Wnk1 A G 6: 119,942,705 (GRCm39) L774S possibly damaging Het
Zfp189 T C 4: 49,530,081 (GRCm39) S395P probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAACCTGGCCCTAACAAGGTC -3'
(R):5'- AAAGTCCTTGCAAAACTGGCC -3'

Sequencing Primer
(F):5'- TGGCCCTAACAAGGTCCTCTAG -3'
(R):5'- AAACTGGCCCTCCACCTGTG -3'
Posted On 2015-10-21