Incidental Mutation 'R3925:Trp53rkb'
ID356347
Institutional Source Beutler Lab
Gene Symbol Trp53rkb
Ensembl Gene ENSMUSG00000042854
Gene Nametransformation related protein 53 regulating kinase B
SynonymsNori-2, 4933401B08Rik, Trp53rk, mNori-2p, PRPK, 5630401H01Rik
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R3925 (G1)
Quality Score59
Status Validated
Chromosome2
Chromosomal Location166792531-166799505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166795472 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 116 (Y116C)
Ref Sequence ENSEMBL: ENSMUSP00000115353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065753] [ENSMUST00000151826]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051923
Predicted Effect probably benign
Transcript: ENSMUST00000065753
SMART Domains Protein: ENSMUSP00000066907
Gene: ENSMUSG00000042854

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 107 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151826
AA Change: Y116C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115353
Gene: ENSMUSG00000042854
AA Change: Y116C

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 189 1.1e-6 PFAM
Pfam:Pkinase 25 201 5.8e-9 PFAM
Pfam:Kdo 31 216 1.4e-13 PFAM
Pfam:RIO1 36 185 3.8e-10 PFAM
low complexity region 219 230 N/A INTRINSIC
Meta Mutation Damage Score 0.3106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Trp53rkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Trp53rkb APN 2 166795394 missense probably damaging 1.00
R0200:Trp53rkb UTSW 2 166795683 missense probably damaging 1.00
R0841:Trp53rkb UTSW 2 166795510 missense probably benign 0.02
R1921:Trp53rkb UTSW 2 166795823 missense probably damaging 1.00
R2183:Trp53rkb UTSW 2 166793957 missense possibly damaging 0.52
R3116:Trp53rkb UTSW 2 166794089 intron probably benign
R3977:Trp53rkb UTSW 2 166795526 missense possibly damaging 0.65
R4191:Trp53rkb UTSW 2 166795475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGTAGTCTAAACCCTGTTC -3'
(R):5'- TCCTGAGACAAAGCTCAGCC -3'

Sequencing Primer
(F):5'- ACCCTGTTCCAAAGCAGGTTTAG -3'
(R):5'- GCTCAGCCCAAAGTCGATGAG -3'
Posted On2015-11-02