Incidental Mutation 'R3925:Amn'
ID356348
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Nameamnionless
Synonyms
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3925 (G1)
Quality Score64
Status Validated
Chromosome12
Chromosomal Location111271095-111276426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111275680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021707
AA Change: V367A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Meta Mutation Damage Score 0.1306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111271793 missense probably damaging 0.97
IGL02397:Amn APN 12 111274479 missense possibly damaging 0.77
IGL02962:Amn APN 12 111274517 missense probably damaging 1.00
IGL02974:Amn APN 12 111271141 missense probably benign 0.01
IGL02837:Amn UTSW 12 111271899 missense possibly damaging 0.74
R0357:Amn UTSW 12 111274141 critical splice acceptor site probably null
R1986:Amn UTSW 12 111274997 missense probably damaging 1.00
R1993:Amn UTSW 12 111276092 missense probably damaging 1.00
R2355:Amn UTSW 12 111271812 missense probably damaging 0.99
R3924:Amn UTSW 12 111275680 missense possibly damaging 0.71
R4364:Amn UTSW 12 111271762 missense probably damaging 0.99
R4687:Amn UTSW 12 111276068 missense probably benign 0.35
R6176:Amn UTSW 12 111274156 missense possibly damaging 0.55
R6209:Amn UTSW 12 111275411 missense probably damaging 0.99
R6300:Amn UTSW 12 111274189 missense probably benign 0.16
R6591:Amn UTSW 12 111275397 missense possibly damaging 0.77
R6691:Amn UTSW 12 111275397 missense possibly damaging 0.77
X0025:Amn UTSW 12 111275399 missense probably damaging 1.00
Z1088:Amn UTSW 12 111275683 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGACAGAGTCCGGACCAAC -3'
(R):5'- TCGGATTTCGGAAACCCAGC -3'

Sequencing Primer
(F):5'- ACACCGAGATCCAGGTGGTG -3'
(R):5'- ATACGGGCTCAGCGTCTTCATG -3'
Posted On2015-11-02