Incidental Mutation 'R4014:Mzf1'
ID356349
Institutional Source Beutler Lab
Gene Symbol Mzf1
Ensembl Gene ENSMUSG00000030380
Gene Namemyeloid zinc finger 1
SynonymsZnf42, Zfp121, Zfp98, Mzf2
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4014 (G1)
Quality Score66
Status Validated
Chromosome7
Chromosomal Location13042303-13054764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13043956 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 586 (V586A)
Ref Sequence ENSEMBL: ENSMUSP00000138271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069289] [ENSMUST00000182087] [ENSMUST00000182490] [ENSMUST00000182515]
Predicted Effect probably benign
Transcript: ENSMUST00000069289
SMART Domains Protein: ENSMUSP00000069122
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182087
SMART Domains Protein: ENSMUSP00000138163
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 152 9.06e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182293
Predicted Effect possibly damaging
Transcript: ENSMUST00000182490
AA Change: V586A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138271
Gene: ENSMUSG00000030380
AA Change: V586A

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
SCAN 120 232 1.18e-70 SMART
ZnF_C2H2 436 458 4.87e-4 SMART
ZnF_C2H2 464 486 1.95e-3 SMART
ZnF_C2H2 492 514 1.18e-2 SMART
ZnF_C2H2 520 542 8.6e-5 SMART
ZnF_C2H2 565 587 1.79e-2 SMART
ZnF_C2H2 593 615 7.15e-2 SMART
ZnF_C2H2 621 643 8.47e-4 SMART
ZnF_C2H2 649 671 2.79e-4 SMART
ZnF_C2H2 677 699 1.6e-4 SMART
ZnF_C2H2 705 727 1.67e-2 SMART
ZnF_C2H2 733 755 3.44e-4 SMART
ZnF_C2H2 761 783 2.84e-5 SMART
ZnF_C2H2 789 811 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182515
AA Change: V507A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138387
Gene: ENSMUSG00000030380
AA Change: V507A

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210727
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous mutants are prone to late-onset (>2 yr) neoplasias characterized by infiltration, enlargement and disruption of the liver by monomorphic cells of myeloid origin; hemopoietic progenitors show increased ability to sustain long-term hemopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Mzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Mzf1 APN 7 13044616 missense possibly damaging 0.85
IGL01728:Mzf1 APN 7 13051727 splice site probably benign
IGL02194:Mzf1 APN 7 13043720 missense possibly damaging 0.53
IGL02256:Mzf1 APN 7 13052737 splice site probably benign
IGL02584:Mzf1 APN 7 13052817 missense probably damaging 0.98
IGL02678:Mzf1 APN 7 13052909 missense probably benign 0.00
R0903:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0904:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0905:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1128:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1131:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1280:Mzf1 UTSW 7 13053083 missense probably damaging 0.96
R1400:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1640:Mzf1 UTSW 7 13043270 makesense probably null
R1687:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R4721:Mzf1 UTSW 7 13043296 missense possibly damaging 0.52
R4721:Mzf1 UTSW 7 13043521 missense possibly damaging 0.53
R5511:Mzf1 UTSW 7 13051599 missense possibly damaging 0.95
R5611:Mzf1 UTSW 7 13044627 utr 3 prime probably benign
R5728:Mzf1 UTSW 7 13044058 missense probably benign 0.00
R5868:Mzf1 UTSW 7 13053189 missense probably benign 0.00
R6283:Mzf1 UTSW 7 13053369 intron probably benign
R7059:Mzf1 UTSW 7 13053058 missense probably damaging 0.96
R7066:Mzf1 UTSW 7 13043563 missense possibly damaging 0.92
R7763:Mzf1 UTSW 7 13044091 missense probably damaging 1.00
R8157:Mzf1 UTSW 7 13044352 missense probably damaging 1.00
R8870:Mzf1 UTSW 7 13052909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAGGTCTTGCCACATTCG -3'
(R):5'- AGAGTGTGGCCAGAGCTTTC -3'

Sequencing Primer
(F):5'- AAGGGCCGCTCTCCAGTG -3'
(R):5'- TTTCGGCAGCGCTCCAAC -3'
Posted On2015-11-02