Incidental Mutation 'R3883:Gm10220'
ID356360
Institutional Source Beutler Lab
Gene Symbol Gm10220
Ensembl Gene ENSMUSG00000067698
Gene Namepredicted gene 10220
Synonyms
MMRRC Submission 040796-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R3883 (G1)
Quality Score49
Status Validated
Chromosome5
Chromosomal Location26114764-26121421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26116910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 255 (S255A)
Ref Sequence ENSEMBL: ENSMUSP00000085569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088236
AA Change: S255A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085569
Gene: ENSMUSG00000067698
AA Change: S255A

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.6e-25 PFAM
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mtrf1 A G 14: 79,419,267 Y403C probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Olfr961 A G 9: 39,647,124 I133V probably benign Het
Pde4dip T C 3: 97,713,188 K1632E probably damaging Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Tap1 T A 17: 34,193,258 V479E probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Gm10220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Gm10220 APN 5 26118611 missense possibly damaging 0.94
IGL01782:Gm10220 APN 5 26117023 missense probably damaging 1.00
IGL03194:Gm10220 APN 5 26121233 missense probably damaging 1.00
IGL03218:Gm10220 APN 5 26118698 missense probably damaging 0.99
IGL03255:Gm10220 APN 5 26116901 missense possibly damaging 0.93
R3014:Gm10220 UTSW 5 26117828 missense probably damaging 0.99
R4577:Gm10220 UTSW 5 26117871 missense probably benign
R5484:Gm10220 UTSW 5 26117932 missense possibly damaging 0.59
R6358:Gm10220 UTSW 5 26120305 intron probably null
Predicted Primers PCR Primer
(F):5'- CACTTTTAGCAGCACAGCCC -3'
(R):5'- TATTGGGAGACTGCAGCCTG -3'

Sequencing Primer
(F):5'- TTTAGCAGCACAGCCCTCCAG -3'
(R):5'- AGACTGCAGCCTGAGAGC -3'
Posted On2015-11-09